TABLE 10.

Possible effects of SNP rs3816527 on alternative splicing of PTX3 pre-mRNA^a

3′ reference motif	Reference score	Mutated motif	Mutation score	Variation (%)
gtgtgtatcccgtactctagCCA	4.47	gtgtgtatcccgtactctagCCA	4.47	+0
CGCCGTGCGACTGCGGTCAGGAG	1.69	cgccgtgcgcctgcggtcagGAG	4.1	+342.6

^aThe Human Splicing Finder system allowed the identification and prediction of a new possible cryptic site on PTX3 pre-mRNA with a high score variation. The C/A change (boldface) generates a cryptic site (italics). As a result, 23 nucleotides of exon 2 (uppercase) become part of the intron sequence (lowercase).