TABLE 10.
Possible effects of SNP rs3816527 on alternative splicing of PTX3 pre-mRNAa
3′ reference motif | Reference score | Mutated motif | Mutation score | Variation (%) |
---|---|---|---|---|
gtgtgtatcccgtactctagCCA | 4.47 | gtgtgtatcccgtactctagCCA | 4.47 | +0 |
CGCCGTGCGACTGCGGTCAGGAG | 1.69 | cgccgtgcgcctgcggtcagGAG | 4.1 | +342.6 |
The Human Splicing Finder system allowed the identification and prediction of a new possible cryptic site on PTX3 pre-mRNA with a high score variation. The C/A change (boldface) generates a cryptic site (italics). As a result, 23 nucleotides of exon 2 (uppercase) become part of the intron sequence (lowercase).