KEY RESCOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| 4G2 | ATCC | Cat. #HB-112 RRID: CVCL_J890 |
| PerCP/Cy5.5 anti-mouse CD3e (clone: 145-2C11) | TONBO Biosciences | Cat. #65-0031-U100 RRID: AB_394599 |
| Brilliant Violet 510 anti-mouse CD8a (clone: 53-6.7) | BioLegend | Cat. #100751 RRID: AB_2561389 |
| CD4 Monoclonal Antibody APC-eFluor 780 (clone: GK1.5), eBioscience | Thermo Fisher Scientific | Cat. #47-0041-82 RRID: AB_11218896 |
| CD19 Monoclonal Antibody PE (eBio1D3 (1D3)), eBioscience | Thermo Fisher Scientific | Cat. #12-0193-83 RRID: AB_657660 |
| PerCp/Cy5.5 anti-mouse CD138 (Syndecan-1) (clone: 281-2) | BioLegend | Cat. #142510 RRID: AB_2561601 |
| BD Pharmingen FITC rat anti-mouse IgD (clone: 11-26c.2a) | BD Biosciences | Cat. #553439 RRID: AB_394859 |
| EDE1 C8 | Ralph Baric (Swanstrom, Plante et al., 2016) | N/A |
| EDE1 C10 | Ralph Baric (Swanstrom, Plante et al., 2016) | N/A |
| In vivo MAb rat IgG1 isotype control, anti-horseradish peroxidase (clone: HPRN) | BioXCell | Cat. #BE0088 RRID: AB_1107775 |
| BD Pharmingen PE-labeled anti-human CD209 (clone: DCN46) | BD Biosciences | Cat. #551265 RRID: AB_394123 |
| In vivo Mab anti-mouse TNFα (clone: XT3.11) | BioXCell | Cat. #BE0058 RRID: AB_1107764 |
| Peroxidase conjugated affini-pure goat anti-mouse IgG F(ab’)2 fragment | Jackson ImmunoResearch | Cat. #115-035-072 RRID: AB_2338507 |
| Peroxidase conjugated affini-pure goat anti-mouse IgG Fcγ | Jackson ImmunoResearch | Cat. #115-035-008 RRID: AB_2313585 |
| Bacterial and Virus Strains | ||
| ZIKV (SD001) | Carlin et al., Submitted | N/A |
| DENV2 (S221) | Yauch, Zellweger et al., 2009 | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Cytofix/Cytoperm | BD Biosciences | Cat. #554714 |
| Qiamp Viral Mini Kit | Qiagen | Cat. #52904 |
| RNAlater | Thermo Fisher Scientific | Cat. #AM7021 |
| QuantaBio qScript one-step qRT-PCR kit | VWR | Cat. #101414-172 |
| eBioscience TMB solution | Thermo Fisher Scientific | Cat. #00-4201-56 |
| Experimental Models: Cell Lines | ||
| Aedes albopicticus: C6/36 | ATCC | Cat. #ATCC: CRL-1660 RRID: CVCL_Z230 |
| Baby Hamster Kidney (BHK)-21 | ATCC | Cat. #ATCC: CCL-10 RRID: CVCL_1915 |
| U937-DC SIGN cells | ATCC | Cat. #CRL-3253 RRID: CVCL_2Z95 |
| Experimental Models: Organisms/Strains | ||
| Mouse: LysMCre+Ifnar1fl/fl C57BL/6 | Michael S. Diamond (Clausen, Burkhardt et al., 1999) | N/A |
| Oligonucleotides | ||
| DENV2 forward primer: CATATTGACGCTGGGAAAGA | Prestwood, Prigozhin et al., 2008 | N/A |
| DENV2 reverse primer: AGAACCTGTTGATTCAAC | Prestwood, Prigozhin et al., 2008 | N/A |
| 18S forward primer: CGGCTACCACATCCAAGGAA | Prestwood, Prigozhin et al., 2008 | N/A |
| 18S reverse primer: GCTGGAATTACCGCGGCT | Prestwood, Prigozhin et al., 2008 | N/A |
| DENV2 probe – [Fam]-TGCTGGCCTC – [TamraQ] | Eurofins | N/A |
| 18S probe – [Fam] – CTGTCTGGCA – [TamraQ] | Eurofins | N/A |
| Software and Algorithms | ||
| FlowJo version 10 | FlowJo | https://www.flowjo.com/ |
| Graphpad Prism 7 | Graphpad Prism Software | https://www.graphpad.com/ |
| Other | ||
| Pierce FITC antibody labelling kit | Thermo Fisher Scientific | Cat. #53027 |
| Nab Protein G Spin Kit | Thermo Fisher Scientific | Cat. #89979 |
| Slide-A-Lyzer | Thermo Fisher Scientific | Cat. #66212 |
| Mouse TNF-α Quantikine ELISA kit | R&D Systems | Cat. #MTA00B |
| ZIKV E protein Suriname strain | Native Antigen Company | Cat. #ZIKVSU-ENV |
| KPL True Blue | SeraCare | Cat. #5510-0030 |