Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Drosophila melanogaster) |
Rop | NA | FLYB: FBgn0004574 |
|
| Gene (D. melanogaster) |
Rim | NA | FLYB: FBgn0053547 |
|
| Gene (D. melanogaster) |
Rbp | NA | FLYB: FBgn0262483 |
|
| Gene (D. melanogaster) |
unc-13 | NA | FLYB: FBgn0025726 |
|
| Gene (D. melanogaster) |
Syx1A | NA | FLYB: FBgn0013343 |
|
| Strain - strain background |
WT - w1118 | NA | w1118 | |
| Genetic reagent (D. melanogaster) |
RopG27 | Bloomington Drosophila Stock Center |
BDSC: 4381 FLYB FBst0 004381 RRID: DGGR_107715 |
Flybase symbol: bw(Aravamudan et al., 1999); Rop[G27] st(Aravamudan et al., 1999)/TM6B, Tb[+] |
| Genetic reagent (D. melanogaster) |
DfRop (Df(3L)
BSC735) |
Bloomington Drosophila Stock Center |
BDSC: 26833 FLYB FBst0026833 RRID: BDSC_26833 |
Flybase symbol: w[1118]; Df(3L) BSC735/TM6C, Sb (Aravamudan et al., 1999) cu(Aravamudan et al., 1999) |
| Genetic reagent (D. melanogaster) |
elavC155-
GAL4 |
Bloomington Drosophila Stock Center |
BDSC: 458 FLYB FBst0000458 RRID: BDSC_458 |
Flybase symbol: P{w[+mW.hs]=GawB}elav[C155] |
| Genetic reagent (D. melanogaster) |
UAS-Rop RNAi | Vienna Drosophila RNAi Center |
VDRC: 19696 FLYB FBst0 453580 RRID: FlyBase_FBst0453580 |
Flybase symbol: w[1118]; P{GD1523}v19696/TM3 |
| Genetic reagent (D. melanogaster) |
rim103; rim | (Müller et al., 2012b) PMID: 23175813 | ||
| Genetic reagent (D. melanogaster) |
rbpSTOP1 | (Liu et al., 2011) PMID: 22174254 | gift from Stephan Sigrist |
|
| Genetic reagent (D. melanogaster) |
dunc-13P84200 | Kyoto Stock Center |
KSC: 101911 RRID: DGGR_101911 |
Flybase symbol: ry[506]; P{ry11}l(4)ry16 (Aravamudan et al., 1999) /ci[D] |
| Genetic reagent (D. melanogaster) |
syx1AΔ229 | Kyoto Stock Center |
KSC: 107713 RRID: DGGR_107713 |
Flybase symbol: Syx1A[Delta229] ry[506]/TM3, ry[RK] Sb(Aravamudan et al., 1999) Ser(Aravamudan et al., 1999) |
| Genetic reagent (D. melanogaster) |
RopG11 | (Harrison et al., 1994) PMID: 7917291 | gift from Hugo Bellen |
|
| Recombinant DNA reagent | PMAL- c5E (vector) |
New England Biolabs |
NEB: N8110 | |
| Recombinant DNA reagent |
PGEX-4T1 (vector) | Addgene | 27-4580-01 | |
| Recombinant DNA reagent |
Rop (cDNA) | Drosophila Genomics Resource Center |
DGRC: SD04216 |
|
| Recombinant DNA reagent |
Syx1A (cDNA) | Drosophila Genomics Resource Center |
DGRC: LD43943 |
|
| Recombinant DNA reagent |
PMAL-RopWT
(plasmid) |
This paper | Primers CGCGGATCCATGGCCTTGAAAGTGCTGGTGG and CC GGAATTCTTAGTCCTCC TTCGAGAGACTGC were used to amplify Rop, which was then cloned into PMAL-5ce vector |
|
| Recombinant DNA reagent |
PMAL-RopG11
(plasmid) |
This paper | Generated using site-directed mutageneis with primer GGCGGGTGCTGGTGGTGAACAAGCTGGGTATGCGC |
|
| Recombinant DNA reagent |
PGEX-Syx1AΔC
(plasmid) |
This paper | Primers CGCGGATCCA TGACTAAAGA CAGATTAGCCG and TCCCCCGGG TTACATGAAATAAC TGCTAACAT were used to amplify Syx1A, which was then cloned into PGEX-4T1, site- directed mutagenesis with primer GTAAAGCCCGA CGAAAG TAGATCATGAT ACTGATC was used to remove the C-terminal tail |
|
| Peptide, recombinant protein |
MBP-RopWT
/MBP-RopG11 |
This paper | Recombinant MBP-Rop was expressed from PMAL-Rop in RosettaTM cells, purified using amylose resin, and eluted with maltose |
|
| Peptide, recombinant protein |
GST-Syx1AΔC | This paper | Recombinant GST-Syx1AΔC was expressed from PGEX- Syx1AΔC in RosettaTM, purified using GST resin, and eluted with glutathione |
|
| Commercial assay or kit |
QuikChange Lightning Site- Directed Mutagenesis Kit |
Agilent | 210518 | |
| Commercial assay or kit |
Coomassie Blue R-250 Solution |
TekNova | C1050 | |
| Chemical compound, drug |
Phorbol 12-myristate 13-acetate Phorbol Ester (PdBU) |
Sigma-Aldrich | Sigma- Aldrich CAS: 16561-29-8 |
Stock concentration: 10 mM Final Concentration (in HL3 saline): 1 μM |
| Chemical compound, drug |
Philanthotoxin- 433 (PhTX) |
Sigma-Aldrich (disc.) Santa Cruz Biotech. |
Sigma Aldrich CAS: 276684-27-6 Santa Cruz Biotech. sc-255421 |
Stock concentration: 5 mM Final Concentration (in HL3 saline): 10–20 μM |
| Software, algorithm |
Sharp- electrode recordings |
Molecular Devices | Clampex (10.3.1.5) | |
| Software, algorithm |
EPSP analysis | Molecular Devices | Clampfit (10.3.1.5) | |
| Software, algorithm |
EPSC and Pr analysis |
Wave-Metrics | Igor Pro (6.3.4.1) RRID: SCR_000325 |
custom script |
| Software, algorithm |
RRP, train analysis |
(Müller et al., 2015) | ||
| Software, algorithm |
mEPSP analysis | Synaptosoft | Mini Analysis 6.0.7 RRID: SCR_002184 |
|
| Software, algorithm |
GraphPad Prism (7.0 c) | GraphPad | RRID: SCR_002798 | |
| Software, algorithm |
Fiji | NIH | RRID: SCR_002285 | |
| Other | Amylose Resin | New England Biolabs | NEB: E8021 | used to purify MBP recombi nant protein |
| Other | GST Bind Resin | Novagen | 70541 | used to purify GST recombinant protein and for pull-down of recombinant protein |