| Antibodies |
| Rabbit monoclonal anti-Snail |
Cell Signaling Technology |
Cat#3879S; RRID: AB_2255011 |
| Mouse monoclonal anti-Tubulin (clone DM1A) |
Sigma-Aldrich |
Cat#T9026; RRID: AB_477593 |
| Rabbit polyclonal anti-BMAL1 |
This paper |
N/A |
| Bacterial and Virus Strains |
| pAAV-hSyn-DIO-hM3D(Gq)-mCherry |
Krashes et al., 2011 |
Addgene AAV5; 44361-AAV5 |
| AAV5-EF1a-DIO-hChR2(H134R)-EYFP |
Hope Center Viral Vectors Core |
N/A |
| Cowpox virus Brighton Red |
BEI Resources |
NR-88 |
| Zika-SMGC-1, GENBANK: KX266255
|
Isolated from patient (Wang et al., 2016) |
N/A |
| Staphylococcus aureus |
ATCC |
ATCC 29213 |
|
Streptococcus pyogenes: M1 serotype strain: strain SF370; M1 GAS |
ATCC |
ATCC 700294 |
| Biological Samples |
| Healthy adult BA9 brain tissue |
University of Maryland Brain & Tissue Bank; http://medschool.umaryland.edu/btbank/
|
Cat#UMB1455 |
| Human hippocampal brain blocks |
New York Brain Bank |
http://nybb.hs.columbia.edu/ |
| Patient-derived xenografts (PDX) |
Children’s Oncology Group Cell Culture and Xenograft Repository |
http://cogcell.org/ |
| Chemicals, Peptides, and Recombinant Proteins |
| MK-2206 AKT inhibitor |
Selleck Chemicals |
S1078; CAS: 1032350-13-2 |
| SB-505124 |
Sigma-Aldrich |
S4696; CAS: 694433-59-5 (free base) |
| Picrotoxin |
Sigma-Aldrich |
P1675; CAS: 124-87-8 |
| Human TGF-β |
R&D |
240-B; GenPept: P01137
|
| Activated S6K1 |
Millipore |
Cat#14-486 |
| GST-BMAL1 |
Novus |
Cat#H00000406-P01 |
| Critical Commercial Assays |
| EasyTag EXPRESS 35S Protein Labeling Kit |
Perkin-Elmer |
NEG772014MC |
| CaspaseGlo 3/7 |
Promega |
G8090 |
| TruSeq ChIP Sample Prep Kit |
Illumina |
IP-202-1012 |
| Deposited Data |
| Raw and analyzed data |
This paper |
GEO: GSE63473
|
| B-RAF RBD (apo) structure |
This paper |
PDB: 5J17 |
| Human reference genome NCBI build 37, GRCh37 |
Genome Reference Consortium |
http://www.ncbi.nlm.nih.gov/projects/genome/assembly/grc/human/ |
| Nanog STILT inference |
This paper; Mendeley Data |
http://dx.doi.org/10.17632/wx6s4mj7s8.2 |
| Affinity-based mass spectrometry performed with 57 genes |
This paper; and Mendeley Data |
Table S8; http://dx.doi.org/10.17632/5hvpvspw82.1
|
| Experimental Models: Cell Lines |
| Hamster: CHO cells |
ATCC |
CRL-11268 |
|
D. melanogaster: Cell line S2: S2-DRSC |
Laboratory of Norbert Perrimon |
FlyBase: FBtc0000181 |
| Human: Passage 40 H9 ES cells |
MSKCC stem cell core facility |
N/A |
| Human: HUES 8 hESC line (NIH approval number NIHhESC-09-0021) |
HSCI iPS Core |
hES Cell Line: HUES-8 |
| Experimental Models: Organisms/Strains |
|
C. elegans: Strain BC4011: srl-1(s2500) II; dpy-18(e364) III; unc-46(e177)rol-3(s1040) V. |
Caenorhabditis Genetics Center |
WB Strain: BC4011; WormBase: WBVar00241916 |
|
D. melanogaster: RNAi of Sxl: y[1] sc[*] v[1]; P{TRiP.HMS00609}attP2 |
Bloomington Drosophila Stock Center |
BDSC:34393; FlyBase: FBtp0064874 |
|
S. cerevisiae: Strain background: W303 |
ATCC |
ATTC: 208353 |
| Mouse: R6/2: B6CBA-Tg(HDexon1)62Gpb/3J |
The Jackson Laboratory |
JAX: 006494 |
| Mouse: OXTRfl/fl: B6.129(SJL)-Oxtrtm1.1Wsy/J |
The Jackson Laboratory |
RRID: IMSR_JAX:008471 |
| Zebrafish: Tg(Shha:GFP)t10: t10Tg |
Neumann and Nuesslein-Volhard, 2000 |
ZFIN: ZDB-GENO-060207-1 |
|
Arabidopsis: 35S::PIF4-YFP, BZR1-CFP |
Wang et al., 2012 |
N/A |
|
Arabidopsis: JYB1021.2: pS24(AT5G58010)::cS24:GFP(−G):NOS #1 |
NASC |
NASC ID: N70450
|
| Oligonucleotides |
| siRNA targeting sequence: PIP5K I alpha #1: ACACAGUACUCAGUUGAUA |
This paper |
N/A |
| Primers for XX, see Table SX |
This paper |
N/A |
| Primer: GFP/YFP/CFP Forward: GCACGACTTCTTCAAGTCCGCCATGCC |
This paper |
N/A |
| Morpholino: MO-pax2a GGTCTGCTTTGCAGTGAATATCCAT |
Gene Tools |
ZFIN: ZDB-MRPHLNO-061106-5 |
| ACTB (hs01060665_g1) |
Life Technologies |
Cat#4331182 |
| RNA sequence: hnRNPA1_ligand: UAGGGACUUAGGGUUCUCUCUAGGGACUUAGGGUUCUCUCUAGGGA |
This paper |
N/A |
| Recombinant DNA |
| pLVX-Tight-Puro (TetOn) |
Clonetech |
Cat#632162 |
| Plasmid: GFP-Nito |
This paper |
N/A |
| cDNA GH111110
|
Drosophila Genomics Resource Center |
DGRC:5666; FlyBase:FBcl0130415 |
| AAV2/1-hsyn-GCaMP6-WPRE |
Chen et al., 2013 |
N/A |
| Mouse raptor: pLKO mouse shRNA 1 raptor |
Thoreen et al., 2009 |
Addgene Plasmid #21339 |
| Software and Algorithms |
| Bowtie2 |
Langmead and Salzberg, 2012 |
http://bowtie-bio.sourceforge.net/bowtie2/index.shtml |
| Samtools |
Li et al., 2009 |
http://samtools.sourceforge.net/ |
| Weighted Maximal Information Component Analysis v0.9 |
Rau et al., 2013 |
https://github.com/ChristophRau/wMICA |
| ICS algorithm |
This paper; Mendeley Data |
http://dx.doi.org/10.17632/5hvpvspw82.1 |
| Other |
| Sequence data, analyses, and resources related to the ultra-deep sequencing of the AML31 tumor, relapse, and matched normal. |
This paper |
http://aml31.genome.wustl.edu |
| Resource website for the AML31 publication |
This paper |
https://github.com/chrisamiller/aml31SuppSite |
