Table 3.

Diagnostic Resolution of ES Negatives with WGS and Other Modalities of Diagnosis

Details of individuals resolved with WGS, after negative pre-UDN ES and negative ES reanalyses in UDN
Individual Number and Phenotype		UDN WGS Findings	Certainty of Diagnoses and Details	Reasons for negative ES/Other pertinent information
21	7 year-old Hispanic female with acquired microcephaly, speech and motor regression, autism, scoliosis and frequent infections	de novo 41 bp deletion in the MECP2 gene c.1157_1197delTGCCCCC ACCTCCACCTGAGCCCGAGAG CTCCGAGGACCCC p.L386HfsTer5	Certain Rett syndrome (MIM## 312750)	Analytical Approach (Technical limitation of ES in indel detection of >15 bp)	Pre-UDN ES and our reanalyses did not detect variant due to difficulties in indel detection with ES. Phenotyping consistent with a Rett-like syndrome. Manual inspection of ES data enabled visualization of the variant retrospectively
22	11 year-old Caucasian female with multiple congenital anomalies, choanal atresia, bilateral sensorineural hearing loss, mild bilateral optic nerve hypoplasia, Klippel-Feil anomaly and global developmental delays	de novo 43kb deletion on the X-chromosome encompassing exons 1 and 2 of HDAC8 and exons 22-32 of PHKA1. Confirmed by exon array	Certain Cornelia de Lange syndrome 5 (MIM# 300882)	Analytical Approach (Technical limitation of ES in CNV detection)	Prior CMA reported a 33 kb deletion, with only gene reported in the deletion being PHKA1, responsible for X- linked recessive glycogen storage disease type IX
23	14 month-old female with refractory epilepsy/neuromuscular disorder and a family history of the same condition in brother and sister. Parents consanguineous. The individual died at age 20 months with progressive neurological decline	1.8 kb homozygous deletion of exon 5 of the ITPA gene	Highly Likely Epileptic encephalopathy, early infantile, 35 (MIM# 616647)	Analytical Approach (CNV not found on prior WGS due to unknown reasons)	Several regions of homozygosity noted on SNP CMA, encompassing >6.5% of the genome, including the ITPA gene. Affected brother had the same deletion on further testing and parents were confirmed to be carriers
24	3 year-old Caucasian male with abnormal gait, developmental delay and hypotonia	compound heterozygous VUS in CAD c.6320C>G, p.P2107R c.4669C>G, p.L1557V	Tentative Epileptic encephalopathy, early, infantile, 50 (MIM#616457)	Variability in Laboratory Reporting (Interpretation) Not reported due to poor phenotypic fit, since he did not have epilepsy	Being phenotyped for evidence of congenital disorder of glycosylation, since the disorder is due to abnormal glycosylation
25	3 year-old Caucasian male with multiple congenital anomalies, cerebellar hypoplasia, hypomyelination, leukomalacia and developmental delays	de novo inframe indel in SON c.5860_5880delAGCCGCCGCAGCCGCACCCCC p.S1992_R1998del	Tentative ZTTK syndrome (MIM#617140)	Analytical Approach (Variant calling of synonymous variants)	Seven amino acid deletion occurs in RS domain of gene, critical for SON function. Due to good phenotypic fit, further functional studies being pursued through collaboration
Details of the seven cases that were diagnosed by modalities other than ES reanalyses and WGS
Individual Number and Phenotype		Modalities to Diagnosis	Certainty of Diagnoses and Details	Reasons for negative ES/Other pertinent information
14	*8 year-old African American/Caucasian male with macrosomia, glabellar nevus flammeus, hypertelorism and learning difficulties	UDN ES ASXL2 de novo c.2424delC p.P808fs LoF in LoF depleted gene	Certain Shashi-Pena syndrome (MIM#617190)Shashi-Pena syndrome (MIM#617190)	Knowledge Gap (gene-disease relationship not established)	Networking identified five other cases leading to new gene-disease association
15	5 year-old Caucasian female with congenital hypothalamic hamartoblastoma, intractable seizures, microcephaly, profound developmental delay	Clinical Targeted sequencing of all known oral-facial-digital (OFD) syndrome genes negative	Certain OFD syndrome Clinical Diagnosis		UDN WGS negative Phenotyping showed pathognomonic oral, skeletal and radiological features all consistent with an OFD
16	*3 year-old Pakistani female with developmental regression, cerebellar atrophy Parents are first cousins	Sanger sequencing and MLPA of PLA2G6 Homozygous 2431-bp deletion with 7-bp insertion (c.-545_-46+1931delinsCGATCTC) in the 5′UTR region	Certain Infantile neuroaxonal dystrophy (MIM#256600)	Analytical Approach (Difficult region of exome) Commercial ES capture kit did not contain probes for the non-coding exon 1 of PLA2G6	Changes in neurologic phenotype strongly suggestive of infantile neuroaxonal dystrophy leading to Sanger and MLPA
17	6 year-old African American female with macrocephaly, learning difficulties, mild motor incoordination, white matter abnormalities	Radiology reinterpretation of brain MRI identified subcortical cysts and other changes, consistent with HEPACAM associated disorder c.592 G>A p.D198N	Certain Megalencephalic leukoencephalopathy with subcortical cysts 2B (MIM#613926)	Variability in Laboratory Reporting (Interpretation) due to incomplete phenotypic information Commercial ES reported variant as VUS in HEPACAM inherited from mother	Autosomal recessive and dominant phenotypes associated with HEPACAM. Child found to have subcortical cysts not previously detected and found to have classical features of the diagnosis. Mother phenotyped and found to be affected
18	26 year-old Caucasian male with intellectual disability, optic nerve abnormalities, appendicular ataxia, speech impairment and history of seizures	Chromosomal microarray reinterpretation due to interim publication, explains part of the phenotype	Highly Likely 16p11.2 deletion syndrome		The 16p deletion is proximal to the typical 16p11.2 deletion and an interim publication implicated haploinsufficiency of STX1B gene within the interval in intellectual disability and seizures
19	9 year-old Asian/Caucasian female with pterygiae, cleft palate, poor muscle mass, camptodactyly, club feet, progressive scoliosis, distinctive facial features, and similarly affected sister	Clinical	Highly Likely Multiple pterygium syndrome Clinical Diagnosis		Extensive phenotyping of individual and affected sister confirmed clinical, radiological and muscle biopsy changes consistent with multiple pterygium syndrome
20	*18 month-old Hispanic female with progressive joint contractures, gingival hypertrophy, nodules, perianal skin tags and protein losing enteropathy	Sanger sequencing ANTXR2 homozygous insertion c.1073dupC p.Ala359Cysfs*13 Parents confirmed to be carriers	Certain Infantile Systemic Hyalinosis (MIM#228600)	Analytical Approach (Technical limitations) Commercial ES variant calling software did not identify variant that was adjacent to homopolymeric region	Phenotyping pathognomonic for infantile systemic hyalinosis and thus Sanger sequencing of ANTXR2 was performed

CNV= copy number variant, CMA= chromosomal microarray, SNP= Single nucleotide polymorphism

^*Individuals included in previous publications