Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Oligonucleotide primers and fluorogenic probes used in DENV-1 and ZIKV virus qPCR assay.
| Virus detection | Sequence 5′–3′ | Genome position | Fluorophore |
|---|---|---|---|
| DENV-1 reverse primer | CAAAAGGAAGTCGTGCAATA | 8973–8993 | - |
| DENV-1 reverse primer | CTGAGTGAATTCTCTCTACTGAACC | 9084—9109 | - |
| DENV-1 probe | CATGTGGTTGGGAGCACGC | 8998—9017 | FAM/BHQ-1 |
| ZIKV forward primer | AARTACACATACCARAACAAAGTGGT | 9271–9297 | - |
| ZIKV reverse primer | TCCRCTCC CYCTYTGGTCTTG | 9352–9373 | - |
| ZIKV probe | CTYAGACCAGCTGAAR | 9304–9320 | FAM/BHQ-1 |
