Table 2.

Candidate genes with putative DRE site and expressed in GSLCs.

Gene	Function	Expression in GSLCs	Reference	Number of putative DRE sites	Sense/position in bpa	Sequence in Homo sapiens (the core sequence is underlined)
MCUb	Mitochondrial calcium uniporter	Downregulated in the quiescent state	Aulestia et al., 2018	3	S/-240 AS/-207 S/-101	5′ tttgggtgtcaattatgggt 3′ 5′ cccgtaattgactatgtccc 3′ 5′ caactcagtcaagggcttta 3′
MCUb	Mitochondrial calcium uniporter beta subunit			2	AS/-70 AS/-36	5′ ccaggcgctgacgaggagcc 3′ 5′ tgcgccgctgacgcctgcgg 3′
MICU1	Mitochondrial calcium uptake 1			NF
MICU2	Mitochondrial calcium uptake 2			1	AS/-199	5′ ggatgggatgacaggaagag 3′
VDAC1	Voltage-dependent anion channel 1			NF
TRPC3	Transient receptor potential cation channel subfamily C member 3	Upregulated by ING5	Wang et al., 2018	NF
TRPC4	Transient receptor potential cation channel subfamily C member 4			4	AS/-620 AS/-582 S/-355 S/-76	5′ ggctggatgacggctggctg 3′ 5′ cactggctgacctcaagcag 3′ 5′ atccgctgtcagccgtggga 3′ 5′ ccgcgccgtcagtcctcgga 3′
TRPC5b	Transient receptor potential cation channel subfamily C member 5			4	S/-478 S/-465 S/-451 AS/-421	5′ cctacagtgtcagctacccc 3′ 5′ ctacccctgtcagtttcccc 3′ 5′ ttccccgtgtcagtttcttc 3′ 5′ attgtgtgtgactggctgcg 3′
TRPM1	Transient receptor potential cation channel subfamily M member 1			1	S/-34	5′ ccgagggagtcagcagggtg 3′

^aPosition upstream from the ATG; S, sense; AS, anti-sense; ^bputative DRE sites in close proximity. NF, not found, in accordance with the criteria in proximal 5′ upstream sequence between the tata box and the start codon (see details in text).