Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (D. melanogaster) | mNeonGreen-Zld | this paper | Fly line with an N-terminal mNeonGreen fusion tag inserted at the endogenous Zld locus. | |
| Strain, strain background (D. melanogaster) | mEos3.2-Zld | this paper | Fly line with an N-terminal mEos3.2 fusion tag inserted at the endogenous Zld locus. | |
| Strain, strain background (D. melanogaster) | H2B-EGFP | this paper | Fly line with an H2B-EGFP transgene inserted on chromosome 3. Transgene is expressed ubiquitously under the control of a synthetic tubulin promoter. | |
| Strain, strain background (D. melanogaster) | H2B-mEos3.2 | this paper | Fly line with an H2B-mEos3.2 transgene inserted on chromosome 3. Transgene is expressed ubiquitously under the control of a synthetic tubulin promoter. | |
| Strain, strain background (D. melanogaster) |
MCP-mcherry | H Garcia lab | Fly line with MCP-mCherry inserted as a transgene on chromosome 2. | |
| Genetic reagent (D. melanogaster) | sgRNA #1 bicoid | this paper | sgRNA targeting N-terminus of Bcd gene, sequence GCGGAGTGTTTGGGGAAAA | |
| Genetic reagent (D. melanogaster) | sgRNA #1 bicoid | this paper | sgRNA targeting N-terminus of Bcd gene, sequence TAAAAGTTTTGATCTGGCGG | |
| Genetic reagent (D. melanogaster) | sgRNA #1 bicoid | this paper | sgRNA targeting N-terminus of Bcd gene, sequence TGATGGTAAAAGTTTTGATC | |
| Genetic reagent (D. melanogaster) | sgRNA Zelda | M Harrison lab | sgRNA targeting N-terminus of Zld gene, sequence CCTCTGCCGCGTGCAGGGG | |
| Software, algorithm | Spot-On | Hansen et al., 2018, eLife |