| REAGENT or RESOURCE |
SOURCE |
IDENTIFIER |
| Experimental Models: Organisms/Strains |
| Mouse: Tet2−/− (Tet2-KO), Tet2+/−
|
Li et al., 2011 |
N/A |
| Mouse: Morrbid+/−
|
Kotzin et al., 2016 |
N/A |
| Mouse: Shp2E76K |
Xu et al., 2011 |
N/A |
| Mouse: Tlr4-KO |
Jackson Laboratory |
Cat #007727 |
| Mouse: IL6-KO |
Jackson Laboratory |
Cat #002650 |
| Mouse: C57/B6 |
Jackson Laboratory |
Cat #000664 |
| Mouse: BoyJ |
Jackson Laboratory |
Cat #002014 |
| Critical Commercial Assays |
| Multiplex cytokine assays |
Eve Technologies |
#MD31 |
| CFU assays |
StemCell |
#M3434 |
| EasySep Mouse Hematopoietic Progenitor Cell Isolation Kit |
StemCell |
#19856 |
| Rneasy Mini Kit |
Qiagen |
#74104 |
| SuperScript II Reverse Transcriptase |
Fisher Scientific |
#18064014 |
| SYBR Green master mix |
Life Technologies |
#4385612 |
| MAGnify Chromatin Immunoprecipitation System |
Fisher Scientific |
#492024 |
| Genomic DNA purification Kit |
Fisher Scientific |
#K0512 |
| EpiTect Bisulfite Kit |
Qiagen |
#59104 |
| Quest 5-hmC Detection Kit |
Zymo |
#5415 |
| MspI |
NEB |
R0106S |
| HpaI |
NEB |
R0105S |
| Chemicals, Peptides, and Recombinant Proteins |
| LPS |
Sigma |
#L8643 |
| Cremophor |
Sigma |
#C5135 |
| Methylcellulose |
Sigma |
#M0262 |
| Tween-80 |
Fisher Scientific |
#BP338–500 |
| E3330 |
Kelley Laboratory |
N/A |
| SHP099 |
Mohseni Laboratory (Novartis) |
N/A |
| Lysis Buffer |
BD |
#555899 |
| Cytofix/Cytoperm Kit |
BD |
#554714 |
| mIL-3 peptide |
PeproTech |
#213–13 |
| mIL-6 peptide |
PeproTech |
#216–16 |
| mSCF peptide |
PeproTech |
#250–03 |
| Antibodies for Western Blot or CHIP assays |
| phospho-Stat3 |
Cell Signaling Tech |
#9145 |
| Stat3 |
Cell Signaling Tech |
#9139 |
| Antibodies for Flow Cytometry |
| TER-119, PE |
BioLegend |
#116208 |
| Gr1, PE |
BioLegend |
#108408 |
| Mac1, PE |
BioLegend |
#101208 |
| B220, PE |
BioLegend |
#103208 |
| CD3, PE |
BioLegend |
#100206 |
| CD4, PE |
BioLegend |
#116006 |
| CD8a, PE |
BioLegend |
#100708 |
| c-Kit, APC |
BioLegend |
#105812 |
| Sca-1, APC/Cy7 |
BioLegend |
#108126 |
| CD150, PE/Cy5 |
BioLegend |
#115912 |
| CD48, PE/Cy7 |
BioLegend |
#103424 |
| CD127, PE/Cy5 |
BioLegend |
#135016 |
| CD16/32, PE/Cy7 |
bioLegend |
#101318 |
| CD34, FITC |
eBioscience |
#11–0341-85 |
| Annexin V, FITC |
BioLegend |
#640906 |
| 7-AAD |
BioLegend |
#79993 |
| TLR4, PE/Cy7 |
BioLegend |
#145408 |
| IL-6, AF488 |
BD |
#561363 |
| TNFa, AF488 |
BioLegend |
#506315 |
| IL-1b, FITC |
eBioscience |
#11–7114-80 |
| GM-CSF, FITC |
BioLegend |
#505403 |
| Ki67, FITC |
BioLegend |
#652410 |
| NFkB1 (p50), PE |
Cell Signaling Tech |
#24961 |
| phospho-Stat3, AF488 |
Cell Signaling Tech |
#4323 |
| Bim mAb (C34C5), AF488 |
Cell Signaling Tech |
#94805S |
| CD45.2, PerCP/Cy5.5 |
BioLegend |
#109928 |
| CD45.1, PE/Cy7 |
BioLegend |
#110730 |
| Ly-6G, FITC |
BioLegend |
#127606 |
| Oligonucleotides |
| Part-I: Key oligonucleotides for qRT-PCR, See also Table Supplement-1 for information of additional oligonucleotides for qRT-PCR |
|
|
| Morrbid, Forward TCTGAGAATGAGGGGACTGG |
Kotzin, J. J. et al., Nature, 2016 |
N/A |
| Morrbid, Reverse TGTGCTGTGAAGATCCCAAG |
Kotzin, J. J. et al., Nature, 2016 |
N/A |
| II6, Forward AGTTGCCTTCTTGGGACTGA |
Inoue, S. et al., Cancer Cell, 2016 |
N/A |
| II6, Reverse TCCACGATTTCCCAGAGAAC |
Inoue, S. et al., Cancer Cell, 2016 |
N/A |
| Part-II: Oligonucleotides for CHIP-qPCR |
|
|
| Promoter of Morrbid (~130 bp), Forward AGCACGAGTCATCTGGTTCC |
Kotzin, J. J. et al., Nature, 2016 |
N/A |
| Promoter of Morrbid (~130 bp), Reverse ACCCAGTCCCCTCATTCTCA |
Kotzin, J. J. et al., Nature, 2016 |
N/A |
| Part-III: Oligonucleotides for 5mC/5hmC analysis |
|
|
| Promoter of Morrbid (~800 bp), Forward ACC CCC AAG TCT CCTA ACCA |
Kotzin, J. J. et al., Nature, 2016 |
N/A |
| Promoter of Morrbid (~800 bp), Reverse GTT CAA CCT CAG TGC CCAGT |
Kotzin, J. J. et al., Nature, 2016 |
|
| Promoter Region with 4 CpG island sites, Forward ATTTAAGGTTTGGGAAGTTGTTTTT |
This paper |
N/A |
| Promoter Region with 4 CpG island sites, Reverse CAAACACCTCAATCTTCATTATCACTA |
This paper |
|
| Software and Algorithms |
| FlowJo |
FlowJo |
V10.2 |
| Prism |
GraphPad Software |
V6.0 |
| Adobe Illustrator |
Adobe |
CC-2015 |
