Table 1.
design of proto-spacers in zebrafish kif15
| Proto-spacer | Proto-spacer + PAM* seq (5’−3’) | Strand | Location | Activity** |
|---|---|---|---|---|
| k1 | tacactgtaaaccagagccacgg | sense | Exon 3 | N |
| k2 | cttctttctcatcaatcgagagg | sense | Exon 6 | N |
| k3 | ctatgaacgagcacttgcagagg | antisense | Exon 7 | N |
| k4 | ctacgggaggacatcaagagagg | sense | Exon 7 | N |
| k5 | tgaatcttctcgttcacatgcgg | sense | Exon 8 | N |
| k6 | agaagattcacggttcatagagg | antisense | Exon 8 | N |
| k7 | ggggtggcggaacaggcgagtgg | sense | Exon 8 | Y |
| k8 | ggagtccaaggagaccggacagg | sense | Exon 8 | Y |
| k9 | gacaggaagtggtgaacattagg | sense | Exon 8 | N |
| k10 | gaccgagacacatcagagagcgg | antisense | Exon 9 | N |
| k11 | tcttatcaggactctctcggcgg | sense | Exon 10 | N |
| k12 | ggctctttgtgcaaactgcaggg | antisense | Exon 10 | N |
*
: PAM, proto-spacer adjacent motif.
**
: In the Activity column, a “Y” indicates the capability to induce a mutation ratio greater than 10% detected 24 h after injection while an “N” stands for not-detectable.