Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
PCR primers for gRNA template preparation and mutant genotyping
| Primer | sequence (5’−3’) |
|---|---|
| gRNA-template-F | taatacgactcactata + proto spacer + gttttagagctagaaatagc |
| gRNA-template-R | aaaaaaagcaccgactcggtgccac |
| kif15-4F3 | agggatcggtggagaaa |
| kif15-4R5 | cttgcccagagtgtattgt |
| kif15-seqR59 | ctgtccggtctccttggact |
