Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Xenopus tropicalis) |
arid3a | This paper | RefSeq: NM_001011106.1 | |
| Gene (Xenopus tropicalis) |
arid3b | This paper | RefSeq: XM_002938881.4 | |
| Gene (Xenopus tropicalis) |
lhx1 | This paper | RefSeq: NM_001100228.1 |
|
| Genetic reagent (Xenopus laevis) |
Xla.Tg(Xtr.pax8:EGFP) | Ochi, H., et al., 2012; doi: 10.1038/ncomms1851. |
||
| Cell line (Homo sapiens) |
293T | RIKEN BRC CELL BANK |
RCB2202, RRID:SCR_003163 | |
| Transfected construct |
pGL4.23 | Promega | E8411 | |
| Transfected construct |
pGL-lhx1-CNS17-Luc | This paper | New regent. The CNS17 fragments from IS-lhx1-CNS17-β-GFP vector introduced into the SacI and EcoRV sites of pGL4.23 vector. |
|
| Transfected construct |
pGL-lhx1-CNS20-Luc | This paper | New regent. The CNS20 fragments from IS-lhx1-CNS17- β-GFP wereintroduced into the SacI and EcoRV sites of pGL4.23 vector. |
|
| Transfected construct |
pGL-lhx1-CNS35-Luc | This paper | New regent. The CNS35 fragments from IS-lhx1-CNS17- β-GFP vector were introduced into the SacI and EcoRV sites of pGL4.23 vector. |
|
| Antibody | Anti-phospho histone H3 (Ser10) antibody |
Milipore | 06–570 | (1:1000) |
| Antibody | Anti-Arid3a antibody | DSHB | PCRP-ARID3A-1E9, RRID:AB_2618410 | (1:10) |
| Antibody | Alexa 488 -conjugated goat anti-rabbit IgG |
Invitrogen | A11001 | (1:1000) |
| Antibody | Alexa 568-conjugated goat anti-mouse IgG |
Invitrogen, | A11011 | (1:1000) |
| Antibody | Anti-H3K9 (tri-methyl K9) antibody |
Abcam, | ab8898 | (1:750) |
| Antibody | Mouse monoclonal c-Myc (9E10) antibody |
Santa Cruz Biotechnology Inc. |
sc-40, RRID:AB_291323 | (1:750) |
| Recombinant DNA reagent |
Xenopus laevis
hsp70 promoter |
Wheeler, G. N., et al. 2000; doi.org/10.1016/S0960-9822 (00)00596–0 | ||
| Recombinant DNA reagent | IS-β-GFP reporter | Ogino, H., et al., 2008; doi: 10.1242/dev.009548 | ||
| Recombinant DNA reagent | pCS-myc-arid3a | New regent. The PCR product was introduced into the XhoI and XbaI sites of the pCS2 + MT plasmid. | ||
| Recombinant DNA reagent | pCS-his-arid3b | New regent. The PCR product was introduced into the ClaI and XbaI site of the pCS vector. | ||
| Recombinant DNA reagent | hsp70-myc-arid3a-2A-mcherry | This paper | New regent. The PCR amplified myc-arid3a and 2A-mcherry were introduced into the ClaI and XbaI sites of the IS-hsp70-cloning vector. | |
| Recombinant DNA reagent | hsp70-myc-arid3a-2A-EGFP | This paper | New regent. The PCR amplified myc-arid3a and 2A-EGFP were introduced into the ClaI and XbaI sites of the IS-hsp70-cloning vector. | |
| Recombinant DNA reagent | hsp70-lhx1-2A-EGFP | This paper | New regent. The PCR amplifiedlhx1 was introduced into the EcoRI sites of the pCS2 + MT plasmid. The PCR amplified myc-lhx1 and 2A-EGFP were introduced into the EcoRI and XbaI sites of the IS-hsp70-cloning vector. | |
| Recombinant DNA reagent (Xenopus laevis) | arid3a.L | This paper | Xelaev18006256m | New regent. The PCR product was introduced into the EcoRI and XhoI sites of the pBluescript II SK plasmid. |
| Recombinant DNA reagent (Xenopus laevis) | arid3a.S | This paper | Xelaev18009788m | New regent. The PCR product was introduced into the EcoRI and XhoI sites of the pBluescript II SK plasmid. |
| Recombinant DNA reagent (Xenopus laevis) | spib. L | This paper | Xelaev18036193m.g | New regent. The PCR product was introduced into the EcoRI and XhoI sites of the pBluescript II SK plasmid. |
| Recombinant DNA reagent (Xenopus laevis) | spib.S | This paper | Xelaev18037903m.g | New regent. The PCR product was introduced into the EcoRI and XhoI sites of the pBluescript II SK plasmid. |
| Recombinant DNA reagent (Xenopus laevis) | hnf4a | This paper | Xelaev17043619m, Xelaev17043619m | New regent. The PCR product was introduced into the BamHI and HindIII sites of the pBluescript II SK plasmid. |
| Recombinant DNA reagent (Xenopus laevis) | hnf1b | This paper | Xelaev18012186m.g, Xelaev18014991m.g | New regent. The PCR product was introduced into the BamHI and HindIII sites of the pBluescript II SK plasmid. |
| Recombinant DNA reagent (Xenopus laevis) | osr1 | This paper | Xelaev14054577m.g, Xelaev14010174m.g | New regent. The PCR product was introduced into the XhoI and BamHI sites of the pBluescript II SK plasmid. |
| Recombinant DNA reagent (Xenopus laevis) |
osr2 | This paper | Xelaev14045820m.g, Xelaev14031017m.g | New regent. The PCR product was introduced into the XhoI and BamHI sites of the pBluescript II SK plasmid. |
| Recombinant DNA reagent (Xenopus laevis) | six2 | This paper | Xelaev16000858m, Xelaev16036496m | New regent. The PCR product was introduced into the HindIII and XhoI sites of the pBluescript II SK plasmid. |
| Recombinant DNA reagent (Xenopus laevis) | lhx1 | This paper | Xelaev16044871m.g | New regent. The PCR product was introduced into the SmaI and HindIII sites of the pBluescript II SK plasmid. |
| Recombinant DNA reagent (Xenopus laevis) | pax2 |
Heller and Brändli, 1997: doi.org/10.1016/S0925- 4773(97)00158-5 |
||
| Recombinant DNA reagent (Xenopus laevis) | pax8 |
Heller and Brändli, 1999: doi.org/10.1002/(SICI)1520- 6408(1999)24:3/4 < 208::AID- DVG4 > 3.0.CO;2 J |
||
| Recombinant DNA reagent (Mus musculus) | kdm4a | Mammalian Gene Collection (MGC) Clones | 4207552 | BC028866 |
| Sequence-based reagent (Xenopus tropicalis) | PCR primers for CNS | This paper | ||
| Sequence-based reagent (Xenopus laevis) | ChIP-qPCR primers | This paper | ||
| Sequence-based reagent (Xenopus laevis) |
Photo-Morpholino oligonucleotide for arid3a,L |
This paper | Gene Tools, LLC | AGAGGGAAGCCAGCAGGTACTCACC |
| Sequence-based reagent (Xenopus laevis) | Morpholino oligonucleotide for arid3a,L |
This paper | Gene Tools, LLC | AGTACCTGpTGGCTTCCCT |
| Sequence-based reagent (Xenopus laevis) | PT-PCR primers for arid3a.L | This paper | ||
| Sequence-based reagent (Homo sapiens) | hg19 chr17-34994909–35360679 | hg19 | UCSC Genome Browser, RRID:SCR_005780 | |
| Sequence-based reagent (Mus musculus) | mm10 chr11-83838963–85151744 | mm10 | UCSC Genome Browser, RRID:SCR_005780 | |
| Sequence-based reagent (Monodelphis domestica) | monDom5 chr2-185210169–185976291 | monDom5 | UCSC Genome Browser, RRID:SCR_005780 | |
| Sequence-based reagent (Xenopus tropicalis) | xenTro3 GL173152-472286-845619 | xenTro3 | Xenbase, RRID:SCR_003280 | |
| Sequence-based reagent (Danio rerio) | danRer10-chr15_27468859–28180541 | danRer10 | UCSC Genome Browser, RRID:SCR_005780 | |
| Sequence-based reagent (Danio rerio) |
danRer10- chr5_55422952–55633560 |
danRer10 | UCSC Genome Browser, RRID:SCR_005780 | |
| Software, algorithm | GraphPad Prism 7.0 | GraphPad Software | RRID:SCR_002798 | |
| Software, algorithm | Adobe Photoshop | Adobe | RRID:SCR_014199 | |
| Software, algorithm | MultiPipMaker | Schwartz, S., et al., 2000: doi: 10.1101/gr.10.4.577 |
RRID:SCR_011806 | |
| Software, algorithm | JASPAR ver. 5 | Mathelier, A., et al., 2014: doi: 10.1093/nar/gkt997. | RRID:SCR_003030 | |
| Commercial assay or kit | ISOGEN | NIPPON GENE | Code No. 317–02503 | |
| Commercial assay or kit | Dual-Luciferase Reporter Assay System | Promega | E1910 | |
| Commercial assay or kit | Dynabeads Protein A | Dynabeads | 10001D | |
| Chemical compound, drug | jetPEI (transfection) | Polyplus-transfection SA | 101–10N |