REAGENT or RESOURCE	SOURCE	IDENTIFIER
Chemicals, Peptides, and Recombinant Proteins
Abscisic acid	Sigma Aldrich	Cat# A1049–250MG
Aphidicolin from Nigrospora sphaerica	Sigma Aldrich	Cat# A0781–5MG
Polyethylenimine (PEI)	Polysciences	Cat# 23966–1
FxCycle Far Red	Thermo Fisher Scientific	Cat# F10348
RNaseA	Qiagen	Cat# 19101
Hygromycin B	Gibco	Cat# 10–687-010
Puromycin Dihydrochloride	Gibco	Cat# A1113803
Blasticidin S HCl	Gibco	Cat# A1113903
LightCycler® 480 SYBR Green I Master	Roche	Cat# 4887352001
DpnII (1,000 units; 10,000 units/ml)	NEB	Cat# R0543S
Critical Commercial Assays
Genomic DNA extraction: DNeasy Tissue kit	Qiagen	Cat# 69506
Click-iT Plus EdU Pacific Blue Flow Cytometry Assay Kit	Thermo Fisher Scientific	Cat# C10636
RNeasy Plus Mini Kit	Qiagen	Cat# 74134
QIAshredder	Qiagen	Cat# 79656
CellTrace Far Red Cell Proliferation Kit	Thermo Fisher Scientific	Cat# C34564
Deposited Data
Raw RNA sequencing data	This study	SRA: PRJNA488081
Human genome sequence	UCSC Genome Browser	Version hg38; https://genome.ucsc.edu /
Experimental Models: Cell Lines
HEK293FT	Thermo Fisher Scientific	Cat# R70007
Human: Interspersed Reporter (pMinCMV)	This study	MP153
Human: Clustered Reporter. (pMinCMV)	This study	MP175
Human: Intrs. pMinCMV Reporter + synRVP64	This study	MP243
Human: Intrs. pMinCMV Reporter + synIIND + synRVP64	This study	MP244
Human: Clust. pMinCMV Reporter + synRVP64	This study	MP252
Human: Clust. pMinCMV Reporter + synIIND + synRVP64	This study	MP253
Human: Intrs. pMinCMV Reporter + synRVP64 +  synRW(pUBC-DpnI-Dam(R95A))	This study	MP422
Human: Intrs. pMinCMV Reporter + synIIND + synRVP64 +  synRW(pUBC-DpnI-Dam(R95A))	This study	MP423
Human: Clust. pMinCMV Reporter + synRVP64 +  synRW(pUBC-DpnI-Dam(R95A))	This study	MP427
Human: Clust. pMinCMV Reporter + synIIND + synRVP64 +  synRW(pUBC-DpnI-Dam(R95A))	This study	MP428
Additional derived cell lines and further information	This study	Table S2
Oligonucleotides
no GATC reference (GFP) forward qPCR primer  GTGAACCGCATCGAGCTGAAG	This study	N/A
no GATC reference (GFP) reverse qPCR primer  TGTTGCCGTCCTCCTTGAAGTC	This study	N/A
GATC (20bp from ZF BS) forward qPCR primer  TAAAGGCTTACTGAGCACTA	This study	N/A
GATC (20bp from ZF BS) reverse qPCR primer  TGTGATTCAGAGACAACTTC	This study	N/A
GATC (140bp from ZF BS) forward qPCR primer  AATCGTTGCGTAATCTACAA	This study	N/A
GATC (140bp from ZF BS) reverse qPCR primer  TTGCGAAAGTTGGAGAAATA	This study	N/A
Additional oligonucleotide pairs and qPCR conditions	This study	Table S3
Recombinant DNA
pUBC ZF-VP64	This study	pMP258
Inters. (8XZFBS 14XGATC)-pMinCMV-GFPd2-RbGpA  pGK-PuroR-T2A-mCh-BGHpA AAVS1 donor	This study	pMP472
Clust. (5XZFBS 63XGATC)-pMinCMV-GFPd2-RbGpA  pGK-PuroR-T2A-mCh-BGHpA AAVS1 donor	This study	pMP498
pMinCMV-NLS-ABI1cs-ZF-NLS-P2A-Dam(N132A)-  PYL1cs-HA pGK-BlastR	This study	pMP597
pUBC-DpnI(aa146–254)-VP64-V5 pGK-ZeoR	This study	pMP650
pUBC-DpnI(aa146–254)-3XFLAG-Dam(R95A) pGK-HygroR	This study	pMP926
pUBC-mCh-3XFLAG-Dam(R95A) pGK-HygroR	This study	pMP967
gRNA_AAVS1-T2 plasmid	(Mali et al., 2013)	Addgene: #41820
VP12 humanSpCas9-Hf1 plasmid	(Kleinstiver et al.,2016)	Addgene: #72247
Additional recombinant DNA constructs and further  information	This study	Table S1
Software and Algorithms
FlowJo v8	FlowJo, LLC.	https://www.flowjo.com/solutions/flowjo/downloads
GraphPad Prism	GraphPad Software	https://www.graphpad.com/scientific-software/prism/
Bowtie2	(Langmead and Salzberg, 2012)	http://bowtie-bio.sourceforge.net/bowtie2/index.shtml
TopHat	(Trapnell et al., 2009)	http://ccb.jhu.edu/software/tophat/index.shtml
featureCounts	(Liao et al., 2014)	http://bioinf.wehi.edu.au/featureCounts/
EMBOSS-dreg	(Rice et al., 2000)	http://www.bioinformatics.nl/cgibin/emboss/dreg
Other
Attune NxT Flow Cytomete	Thermo Fisher  Scientific	Attune NxT
LightCycler 480 Instrument II	Roche	Cat# 05015243001