Table 2. The primers used in detection of the viruses.

Virus	Forward primer 5′–3′	Reverse primer 5′–3′	Product size (nt)	Annealing tm	Approximate sites in the reference genome	Reference accession	Reference
Plantago latent caulimovirus	CAMV_strain_7R TGAAGTTTTTATTATCCGTTCGTACC	CAMV_strain_7F CAAAGCAAATAAAGGAATTACTTGACC	1,089	50	4,404–5,492	AB863200.1	This study
Plantago lanceolata latent virus	CapulaPlantago_1F CAGTCCACACTTCCGCAGTA	CapulaPlantago_2R AACCACACCACCCCAATATC	607	52	1,706–2,313	KT214390.1	Susi et al. (2017)
Plantago betapartitivirus	Hop_1F TCCGTCCTGTTTATGCTGTTGA	Hop_4R TCTTGCAGACATAGTGTGAGGC	974	53	1,136–2,110	NC_021098.1	This study
Plantago enamovirus	Polero_1F GGCTGGCCAAAGAAGGGG	Polero_4 R GCCAGGTTAGTCGACGTGCTCT	929	57	–	–	This study
Plantago closterovirus	Clostero_2F GATTTACCCCAGAACTGTTGGGTG	Clostero_9014R CTAACTTCTTCAGTTAAAGCGCGAGAA	790	50	–	–	This study