| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| PE-Cy7 rat monoclonal anti-mouse CD45 (clone 30-F11) | Thermo Fisher | Cat#25-0451-82; RRID:AB_469625 |
| Pe-Cy7 rat monoclonal anti-mouse TER-119 (clone TER-119) | Thermo Fisher | Cat#25-5921-82; RRID:AB_469661 |
| PE-Cy7 rat monoclonal anti-mouse CD31 (PECAM) (clone 390) | Thermo Fisher | Cat#25-0311-82; RRID:AB_469615 |
| APC rat monoclonal anti-mouse CD326 (EpCAM) (clone G8.8) | Thermo Fisher | Cat#17-5791-82; RRID:AB_1659714 |
| PE rat monoclonal anti-mouse CD24 (clone M1/69) | Thermo Fisher | Cat#12-0242-82; RRID:AB_465602 |
| APC rat monoclonal anti-human/mouse CD49f (clone GoH3) | Thermo Fisher | Cat#17-0495-82; RRID:AB_2016694 |
| eFluor®450 rat monoclonal anti-human/mouse CD49f (clone GoH3) | Thermo Fisher | Cat#48-0495-82; RRID:AB_11042564 |
| PE armenian hamster monoclonal anti-mouse CD61 (clone 2C9.G3) | Thermo Fisher | Cat#12-0611-82; RRID:AB_465718 |
| Rabbit monoclonal anti-human/mouse c-Myc (clone Y69) | Abcam | Cat# ab32072; RRID:AB_731658 |
| Rat monoclonal anti-human/mouse CD49f (clone GoH3) | BD Biosciences | Cat# 555734; RRID:AB_2296273 |
| Mouse monoclonal anti-Numb (clone AB21) | Colaluca et al., 2008 | N/A |
| Rabbit monoclonal anti-Ki67 (clone SP6) | Thermo Fisher | Cat#RM-9106-S; RRID:AB_149707 |
| Mouse polyclonal anti-Cytokeratin 14 | Covance | Cat#PRB-155P; RRID:AB_292096 |
| Mouse monoclonal anti-Cytokeratin 18 (clone Ks18.04) | Progen | Cat#61028; RRID:AB_1541026 |
| Rabbit polyclonal anti-βcasein | Santa Cruz | Cat#sc30042; RRID:AB_2084343 |
| Rabbit polyclonal anti-GFP | Abcam | Cat#ab6556; RRID:AB_305564 |
| Mouse monoclonal anti-Vinculin (clone hVIN-1) | Sigma-Aldrich | Cat# V9131; RRID:AB_477629 |
| Rabbit polyclonal anti-human/ mouse c-Myc | Cell Signaling | Cat#9402; RRID:AB_2151827 |
| Rabbit polyclonal anti-human/mouse phosphoS15 p53 | Cell Signaling | Cat#9284; RRID:AB_331464 |
| Mouse monoclonal anti-human/mouse p21 (clone F-5) | Santa Cruz | Cat#sc-6246; RRID:AB_628073 |
| Rabbit polyclonal anti-human/mouse cleaved Casp3 | Cell Signaling | Cat#9661; RRID:AB_2341188 |
| Rabbit polyclonal anti-mouse p53 | Novocastra | Cat#NCL-L-p53-CM5p; RRID:AB_563933 |
| Rabbit polyclonal anti-human/mouse c-Myc (N-262) | Santa Cruz | Cat#sc-764; RRID:AB_631276 |
| Biological Samples | ||
| Patient derived xenograft (PDX) samples | Luisa Lanfrancone, Target Identification and Validation (TIV) unit, IEO | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| 4-hydroxytamoxifen (4-OHT) | Sigma | Cat#H7904; CAS#68047-06-3 |
| Nutlin-3 (Nut3) | Sigma | Cat#N6287; CAS#548472-68-0 |
| Adriamycin (Doxorubicin hydrochloride) | Sigma | Cat#D1515; CAS#25316-40-9 |
| Poly-HEMA | Sigma | Cat#P3932; CAS#25249-16-5 |
| Critical Commercial Assays | ||
| Click-iT® EdU Alexa Fluor® 647 Flow Cytometry Assay Kit | Thermo Fisher | Cat#C10424 Lot#1293070 |
| PKH26 red fluorescent cell linker kit for general membrane labeling (PKH26) | Sigma | Cat#PKH26GL |
| Deposited Data | ||
| TCGA breast cancer RNA-seq and clinical data | TCGA Research Network | https://cancergenome.nih.gov/ |
| Raw and analyzed ChIP-seq and RNA-seq data: Regulation of p53- and Myc-targets in normal and tumoral murine mammary epithelial cells | This paper | GEO: GSE87004 |
| Affymetrix Array U133A data: Gene expression of breast cancer tissue in a large population-based cohort of Swedish patients | Pawitan et al., 2005 | GEO: GSE1456 |
| Affymetrix Array U133A data: Gene-expression profiles to predict distant metastasis of lymph-node-negative primary breast cancer | Wang et al., 2005 | GEO: GSE2034 |
| Affymetrix Array U133A data: Genetic Reclassification of Histologic Grade Delineates New Clinical Subtypes of Breast Cancer | Ivshina et al., 2006 | GEO: GSE4922 |
| Affymetrix Array U133A data: Dataset of microarray experiments from primary breast tumors used to validate the 76-gene signature (VERIDEX) | Desmedt et al., 2007 | GEO: GSE7390 |
| Experimental Models: Cell Lines | ||
| MCF10DCIS.com | Miller et al., 2000 | RRID:CVCL_5552 |
| NMuMG | ATCC; Termén et al., 2013 | RRID:CVCL_0075 |
| Experimental Models: Organisms/Strains | ||
| Mouse: GFP/FVB: FVB.Cg-Tg(ACTB-EGFP)B5Nagy/J | Jackson lab | Stock#003516 |
| Mouse: MMTV-ErbB2: FVB-Tg(MMTV-Erbb2)NK1Mul/J | Jackson lab | Stock#005038 |
| Mouse: p53−/−: B6.129S2-Trp53tm1Tyj/J | Jackson lab | Stock#002101 |
| Mouse: Rosa26-MycER (R26-MER) | Murphy et al., 2008 | N/A |
| Mouse: NOD/SCID: NOD.CB17-Prkdcscid/NCrHsd | Envigo | N/A |
| Oligonucleotides | ||
| Primer: GusB Forward GTGGGCATTGTGCTACCTC | This paper | N/A |
| Primer: GusB Reverse ATTTTTGTCCCGGCGAAC | This paper | N/A |
| Primer: c-Myc Forward TTTGTCTATTTGGGGACAGTGTT | This paper | N/A |
| Primer: c-Myc Reverse CATCGTCGTGGCTGTCTG | This paper | N/A |
| Primer: Ncl Forward CATGGTGAAGCTCGCAAAG | This paper | N/A |
| Primer: Ncl Reverse TCACTATCCTCTTCCACCTCCTT | This paper | N/A |
| Primer: Cad Forward GATCATCATGGGGGAGAAAG | This paper | N/A |
| Primer: Cad Reverse CCAAGCGTGAGAAGGAGAAC | This paper | N/A |
| Primer: Odc1 Forward GCTAAGTCGACCTTGTGAGGA | This paper | N/A |
| Primer: Odc1 Reverse AGCTGCTCATGGTTCTCGAT | This paper | N/A |
| Recombinant DNA | ||
| pWPI | Didier Trono | Addgene #12254 |
| pWPI-MycER | Pasi et al., 2011 | N/A |
| pLL3.7 | Rubinson et al., 2003 | Addgene #11795 |
| pLL3.7-mMyc (AP4619/20) - puro | Bruno Amati | N/A |
| insert: mMyc hairpin TGAATTTCTATCACCAGCAATTCAAGAGAT TGCTGGTGATAGAAATTCTTTTTTC | ||
| pLL3.7-mMyc (AP4621/22) – puro insert: mMyc hairpin TGGAGAT GATGACCGAGTTATTCAAGAGATAACTCGGTCATCAT CTCCTTTTTTC |
Bruno Amati | N/A |
| pTRIPZ | Open Biosystems | Cat#RHS4750 |
| pTRIPZ-RFP-Omomyc | Annibali et al., 2014 | N/A |
| pBABE-p53ER | Vater et al., 1996 | N/A |
| Software and Algorithms | ||
| ELDA | Hu and Smyth 2009 | http://bioinf.wehi.edu.au/software/elda/ |
| FlowJo 9.3-2 (or later versions) | FowJo, LLC | https://www.flowjo.com/ |
| ImageJ | Schneider et al., 2012 | https://imagej.net/Welcome |
| bwa (version 0.6.2-r126) | Li and Durbin 2010 | http://bio-bwa.sourceforge.net |
| samtools rmdup tools (version 0.1.18) | Li et al., 2009 | https://github.com/samtools/samtools |
| MACS (version 1.4) | Zhang et al., 2008 | https://github.com/taoliu/MACS/ |
| GIN tool | Cesaroni et al., 2008 | N/A |
| Tophat2 | Kim et al., 2013 | https://ccb.jhu.edu/software/tophat/index.shtml |
| HTSeq (v0.5.3p9) | Anders et al., 2015 | https://github.com/simon-anders/htseq |
| DESeq2 | Anders and Huber 2010 | https://bioconductor.org/packages/release/bioc/html/DESeq2.html |
| GSEA v2.2.0 | Subramanian et al., 2005 | https://www.broadinstitute.org/gsea/ |
| ClustVis | Metsalu and Vilo 2015 | https://biit.cs.ut.ee/clustvis/ |
| cBioportal | Cerami et al., 2012, Gao et al., 2013 | http://www.cbioportal.org/ |
| Mouse Gene Database (MGI) | Blake et al., 2017 | http://www.informatics.jax.org/homology.shtml |
| Broad GDAC Firehose [https://doi.org/10.7908/C11G0KM9] | Broad Institute | https://gdac.broadinstitute.org/ |
| Aroma R package | Bengtsson et al., 2008 | https://cran.rstudio.com/web/packages/aroma.affymetrix/index.html |
| Other | ||
| Tamoxifen diet for rodents | Envigo | TD.130859 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.