Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for real-time RT-PCR in this study
| Gene name | Orientation | (5′→3′) Primer sequence |
|---|---|---|
| β-actin | Forward | ctcaggtgatggtgtctc |
| Reverse | caggtagtcggtcaagtc | |
| termicin | Forward | tcgtctttctggtcgtcgtagtg |
| Reverse | cagtggtgatagagatgata | |
| transferrin | Forward | atgcacggcttgcctgttat |
| Reverse | tgtgtgcgctctgtgagca |
