Table 2.
miRNA qPCR primers
| miRNA | Target Sequence | Exiqon Product No. |
|---|---|---|
| mmu-let-7f-5p | UGAGGUAGUAGAUUGUAUAGUU | 204359 |
| mmu-miR-21–5p | UAGCUUAUCAGACUGAUGUUGA | 204230 |
miRNA, microRNA; qPCR, quantitative polymerase chain reaction.
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.