Table 3.
Strains, plasmids, and primers used in this study.
| Strain, plasmid or primer | Description | Source or reference | Addgene ID |
|---|---|---|---|
| Strain | |||
| E. coli strains | |||
| α-Select Gold | Competent cells. Genotype: F – deoR endA1 recA1 relA1 gyrA96 hsdR17(rk-, mk + ) supE44 thi-1 phoA Δ(lacZYA argF)U169 Φ80lacZΔM15λ - | Bioline | |
| DH5α | Competent cells. Genotype: F- Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 λ- | Invitrogen | |
| R. leguminosarum bv. viciae 3841 | Rhizobium leguminosarum bv. viciae, derivative of strain 300, Strr | Johnston and Beringer, 1975 | |
| Rhizobium tropici CIAT899 | Rhizobium tropici, Rfr | Graham et al., 1982 | |
| Plasmid | |||
| pJP2 | pTR102 GUS with artificial MCS, Ampr Tetr | Prell et al., 2002 | |
| EC15071 | pL0M-SC-mCherry. Level 0 SC module cloned in pMS, Spr | ENSA, supplied by Invitrogen | |
| pMS | Vector with ColE1 origin of replication in which modules are supplied from Invitrogen, Spr | Invitrogen | |
| pLMB509 | Highly inducible His tag expression vector, Gmr | Tett et al., 2012 | 40084 |
| pOGG001 | pL0M-PU-pNeo, promoter 379 bp upstream from of the start codon of luxC from pIJ11268 of nptII for constitutive gene expression. Level 0 PU module cloned in pMS, Spr | This study | 113978 |
| pOGG003 | pL0M-T-pharma. Level 0 T module cloned in pMS, Spr | Invitrogen | |
| pOGG004 | pLVC-P1-Lv1 (Golden Gate Level 1 cloning site with cloned lacZ) position 1 module for vector construction cloned in pMS, Spr | This study | 113979 |
| pOGG005 | pL1V-Lv1-amp-ColE1, Level 1 cloning vector, high copy number used for protein expression in E. coli, Ampr | This study | 113980 |
| pOGG006 | pLVC-P1-Lv2, Golden Gate Level 2 cloning site, position 1 module for vector construction cloned in pMS, Spr | This study | 113981 |
| pOGG008 | pLVC-P2-neo, neomycin-resistance gene, position 2 module for vector construction cloned in pMS, Spr Nmr/Kanr | This study | 113982 |
| pOGG009 | pLVC-P2-gent, gentamicin-resistance gene, position 2 module for vector construction cloned in pMS, Spr Gmr | This study | 113983 |
| pOGG010 | pLVC-P3-RK2, RK2 origin of replication and oriT from E. coli, position 3 module for vector construction cloned in pMS, Spr | This study | 113984 |
| pOGG011 | pLVC-P3-pBBR1, pBBR1 origin of replication and oriT from E. coli, position 3 module for vector construction cloned in pMS, Spr | This study | 113985 |
| pOGG012 | pLVC-P4-par, partition genes (parABCDE from pMS) for plasmid stability, position 4 module for vector construction cloned in pMS, Spr | This study | 113986 |
| pOGG013 | pLVC-ELT-3, connecting position 3 to position 1 to circulaise vector, endlinker module for vector construction cloned in pMS, Spr | This study | 113987 |
| pOGG014 | pLVC-ELT-4, connecting position 4 to position 1 to circulaise vector, endlinker module for vector construction cloned in pMS, Spr | This study | 113988 |
| pOGG015 | pLVC-ELT-5, connecting position 5 to position 1 to circulaise vector, endlinker module for vector construction cloned in pMS, Spr | This study | 113989 |
| pOGG016 | pLVC-ELT-6, connecting position 6 to position 1 to circulaise vector, endlinker module for vector construction cloned in pMS, Spr | This study | 113990 |
| pOGG021 | Destination vector for pL1V-F1, Ampr | Weber et al., 2011 | |
| pOGG024 | pL1V-Lv1-gent-pBBR1-ELT3, 3.4 kb, medium copy, broad-host range Level 1 cloning vector, Gmr | This study | 113991 |
| pOGG026 | pL1V-Lv1-neo-RK2-par-ELT4, 6.6 kb, low copy, environmentally stable, broad-host range Level 1 cloning vector, Nmr/Kanr | This study | 113992 |
| pOGG030 | pL0M-PU-pT7lacO, IPTG-inducible T7RNAP promoter 88 bp promoter and RBS driving recombinant protein expression in the pET and pOPIN vectors. Level 0 PU module cloned in pMS, Spr | This study | 113993 |
| pOGG031 | pL0M-PU-pLac, IPTG-inducible promoter 250 bp immediately upstream of the lacZ alpha fragment start codon in pRK415. Level 0 PU module cloned in pMS, Spr | This study | 113994 |
| pOGG037 | pL0M-SC-sfGFP, pMS Level 0 SC module cloned in pMS, Spr | This study | 113995 |
| pOGG039 | pL0M-T-T7. Level 0 T module cloned in pMS, Spr | This study | 113996 |
| pOGG041 | pL0M-PU-pTau, Taurine-inducible promoter for Alphaproteobacteria, Level 0 PU module cloned in pMS, Spr | This study | 113997 |
| pOGG042 | pLVC-P2-tet, tetracycline-resistance gene (tetAR) from pJP2. Made by PCR using oxp0734 and oxp0735 primers in position 2 module for vector construction cloned in pMS, Spr, Tetr | This study | 113998 |
| pOGG050 | pL0M-SC-celB. Level 0 SC module cloned in pMS, Spr | This study | 113999 |
| pOGG054 | Destination vector for pL1V-F2, Ampr | Weber et al., 2011 | |
| pOGG056 | Destination vector for Level 2 Endlinker ELB-2, Ampr | Weber et al., 2011 | |
| pOGG068 | Destination vector for pL0V-PU, Spr | Weber et al., 2011 | |
| pOGG072 | Destination vector for pL0V-SC, Spr | Weber et al., 2011 | |
| pOGG082 | pL0M-PU-pNifH, promoter 714 bp upstream of the ATG of nifH for nodule-specific gene expression in R. leguminosarum. Made by PCR using oxp0474 and oxp0475 primers and cloned in destination vector pOGG068, Spr | This study | 114000 |
| pOGG083 | pL0M-SC-gusA, gusA gene from pJP2. Made by PCR using oxp0376 and oxp0377 primers and cloned in destination vector pOGG072. Spr | This study | 114001 |
| pOGG202 | pL1M-F1-plac (pOGG031), sfGFP (pOGG037) and T-pharma (pOGG003), Ampr | This study | 115503 |
| pOGG203 | pL1M-F2-pNeo (pOGG001), mCherry (EC15071) and T-pharma (pOGG003), Ampr | This study | 115504 |
| pOGG216 | pL2V-L2-tet-pBBR1-ELT3, 9.5 kb, medium copy, broad-host range. Level 2 cloning vector, Tetr | This study | 114002 |
| pOPS0253 | Reporter plasmid constructed with Rlv3841PnifH (pOGG082), gusA (pOGG083) and T-pharma (pOGG003) assembled in pOGG026, Nmr/Kanr | This study | 115505 |
| pOPS0254 | Reporter plasmid constructed with Rlv3841PnifH (pOGG082), celB (pOGG050) and T-pharma (pOGG003) assembled in pOGG026, Nmr/Kanr | This study | 115506 |
| pOPS0314 | Reporter Plasmid constructed with constitutive promoter pNeo (pOGG001), celB (pOGG050) and T-pharma (pOGG003) assembled in pOGG026, Nmr/Kanr | This study | 115507 |
| pOPS0359 | Reporter plasmid constructed with pTau (pOGG041), sfGFP (pOGG037) and T-pharma (pOGG003) assembled in pOGG024, Gmr | This study | 115508 |
| pOPS0377 | Reporter Plasmid constructed with constitutive promoter pNeo (pOGG001), sfGFP (pOGG037) and T-pharma (pOGG003) assembled in pOGG026, Nmr/Kanr | This study | 115509 |
| pOPS0379 | Reporter plasmid constructed with Rlv3841PnifH (pOGG082) sfGFP (pOGG037) and T-pharma (pOGG003) assembled in pOGG026, Nmr/Kanr | This study | 115510 |
| pOSP0750 | Reporter Plasmid constructed with constitutive promoter pNeo (pOGG001) gusA (pOGG083) and T-pharma (pOGG003) assembled in pOGG026, Nmr/Kanr | This study | 115511 |
| pOPS0754 | Dual reporter plasmid. Forward position 1 pOGG202, forward position 2 pOGG203 and level 2 Endlinker ELB-2 (pOGG056) assembled in pOGG216, Tetr | This study | 115512 |
| Primer | |||
| oxp0376 | Forward primer for amplification of gusA gene for SC module. Sequence: CACTCTGTGGTCTCAAATGGTCCGTCCTGTAG | This study | |
| oxp0377 | Reverse primer for amplification of gusA gene for SC module. Sequence: CACTTCGTGGTCTCAAAGCTCATTGTTTGCCTCCC | This study | |
| oxp0734 | Forward primer for amplification of tetracycline-resistance gene (tetAR) from pJP2. Used in position 2 module for vector construction. Sequence: TTTTGAAGACAAGAATACAGTCATAAGTGCGGC | This study | |
| oxp0735 | Reverse primer for amplification of tetracycline-resistance gene (tetAR) from pJP2. Used in position 2 module for vector construction. Sequence: TTTTTGAAGACAATGCCGGTCTCCATAACCGGA | This study | |
| oxp0474 | Forward primer for amplification of PnifH region of Rlv3841 plasmid pRL10 for PU module. Sequence: CACTCTGTGGTCTCAGGAGTCGATGCTGACCGCCT | This study | |
| oxp0475 | Reverse primer for amplification of PnifH region of Rlv3841 plasmid pRL10 for PU module. Sequence: CACTTCGTGGTCTCACATTTTTGGCGTTCCTTCATGTGT | This study |
Ampr, ampicillin resistance; Gmr, gentamicin resistance; Kanr, kanamycin resistance; Nmr, neomycin resistance; Rfr, rifampicin resistance, Spr, spectinomycin resistance; Strr, streptomycin resistance; Tetr, tetracycline resistance.