Table 3.
Set of primers used for RT-PCR
| Identifer | Forward primers | Reverse primers |
|---|---|---|
| Gl-GPCRA9 | ggccaacagagtgattgcaa | gtgacgtcggtggtagatcc |
| Gl-GPCRA12 | tgactacaacttcacggacag agc | gtacacgtgcatcttgttcacctc |
| Beta-actin | ctgacaccactccaccatgt | tcatagatggggacggtgtg |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.