Table 1.

Primer sequences employed for Crimean Congo hemorrhagic fever virus (CCHFV) N amplification and plasmid construction. Underlined bold letters indicate up- and down-stream homologous sequences of the plasmid multiple cloning site (EcoRI) of the pVAX-1 vector used in the Seamless Ligation Cloning Extract (SLiCE) cloning method.

Name	Sequence (5′-3′)
CCHFV-N-F a	atggaaaacaagatcgagg
CCHFV-N-R a	aggaggagaaaagctgaa
pVAX-SliCE-N-F b	taagcttggtaccgagctcggatccactagtccagtgtggtggaccatggaaaacaagatcgagg
pVAX-SliCE-N-R b	actcgagcggccgccactgtgctggatatctgcagaattaggaggagaaaagctgaa
CD24-F c	acccacgcagatttattcca
CD24-R c	accacgaagagactggctgt
RE-N-F d	gaattcatggaaaacaagatcgagg
RE-N-R d	ctcgagaggaggagaaaagctgaa
qPCR-F	ggacataggtttccgtgtca
qPCR-R	tccttctaatcatgtctgacagc
qPCR-probe	FAM-agaacaacttgccaattaccaacaggc-BHQ1

^a Based on the CCHFV Turkey-Kelkit06 complete sequence (GenBank accession: GQ337053). ^b Underlined bold letters indicate homologous recombination sequences.: ^c Based on the CD24-expressing Open Reading Frame (ORF) (GenBank accession: NM013230). ^d Underlined regular letters indicate restriction endonuclease recognition sites (EcoRI and XhoI).