Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Primers Pairs (5′–3′) | Primer name | Variations | Genebank no. | Reference |
|---|---|---|---|---|
| F: ATGATTCTAGGAGGGATTACR: CTTTTACGGTTCATATTCTGGATT | psbJ-petA | 21 | MH717109–MH717129 | Newly designed |
| F: ATCTTCATATCTTCATTACGAR: ATTGTTTCCGATTCACCAG | rpl32-ndhF | 13 | MH717130–MH717142 | Newly designed |
| F: CGGGTTGCTAACTCAACGGR: GTTCGTAAAAAATCGATCCA | trnK5’-matK | 8 | MH717143–MH717150 | Fetter (2014) |
