KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-IFNy functional | ThermoFisher | Cat#116-7311-38; RRID:AB_2637490 |
| Anti-IL4 functional | ThermoFisher | Cat#16-7041-95; RRID:AB_2573101 |
| Anti-CD3 functional | ThermoFisher | Cat#16-0038-85; RRID:AB_468857 |
| Anti-CD28 functional | ThermoFisher | Cat#16-0289-85; RRID:AB_468927 |
| Anti-PIK3IP1 | ProteinTech | Cat#16826-1-AP; RRID:AB_2163333 |
| Anti-GLS1 antibody | GeneTex | Cat#GTX81012; RRID:AB_11162809 |
| Anti-IFNy APC | BD | Cat#554413; RRID:AB_398551 |
| Anti-IL17APE | ThermoFisher | Cat#12-7177-81; RRID:AB_763582 |
| Anti-IL2 PE | BD | Cat#554428; RRID:AB_395386 |
| Anti-CD4 e450 | ThermoFisher | Cat#48-0041-82; RRID:AB_10718983 |
| Anti-CD8BV510 | BD | Cat#563068; RRID:AB_2687548 |
| Anti-Thy1.1 e450 | ThermoFisher | Cat#48-0900-82; RRID:AB_1272254 |
| Anti-CD25 e450 | ThermoFisher | Cat#48-0251-82; RRID:AB_10671550 |
| Anti-CD44 PECy5 | ThermoFisher | Cat#15-0441 −82; RRID:AB_468749 |
| Anti-CD62L APC | ThermoFisher | Cat#17-0621-82; RRID:AB_469410 |
| Anti-FOXP3 PE | ThermoFisher | Cat#12-5773-82; RRID:AB_465936 |
| Anti-Tbet PE | ThermoFisher | Cat#12-5825-82; RRID:AB_925761 |
| Anti-Tbet PECy7 | ThermoFisher | Cat#25-5825-82; RRID:AB_11042699 |
| Anti-RORyt APC | ThermoFisher | Cat#12-6988-82; RRID:AB_1834470 |
| Anti-CD19APC | Biolegend | Cat#115512; RRID:AB_313647 |
| Anti-CD45RB | Biolegend | Cat#103320; RRID:AB_2565229 |
| Anti-pS6 PE | Cell Signaling Technology | Cat#5316S; RRID:AB_10694989 |
| Anti-c-Myc PE | Cell Signaling Technology | Cat#14819S |
| Anti-H3K27me3 af647 | Cell Signaling Technology | Cat#12158S |
| Anti-H3K4me3 af647 | Cell Signaling Technology | Cat#12064S |
| Anti-H3 total protein af647 | Cell Signaling Technology | Cat#12230S |
| Isotype PE control | ThermoFisher | Cat#12-4714-42; RRID:AB_1944423 |
| APC-conjugated Tetramers | (Moon et al., 2007) | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Recombinant Mouse IL2 | ThermoFisher | Cat#14-8021-64 |
| Recombinant Mouse IL-7 | Peprotech | Cat#217-17 |
| Recombinant IL12p70 | ThermoFisher | Cat#14-8121-62 |
| Recombinant TGFβ | R&D systems | Cat#100-B-001 |
| Recombinant IL6 | ThermoFisher | Cat#14-8061-80 |
| 2-deoxyglucose | Sigma-Aldrich | Cat#D6134; CAS 154-17-6 |
| Dimethyl 2-oxoglutarate | Sigma-Aldrich | Cat#349631; CAS 13192-04-6 |
| D-Glucose(U-13C6) | Cambridge Isotope Labs | Cat#CLM-1396-1 |
| Deoxy-D-glucose 2-[1,2,3H(N)] | Perkin Elmer | Cat#NET549001MC |
| phase Dinonyl phthalate | Sigma-Aldrich | Cat#80151 |
| Dow Corning Silicon 550 oil | Motion Industries, INC | Cat#784198 |
| Phloretin | Millipore | Cat#524488; CAS 60-82-2 |
| GSKJ4 | Selleckchem | Cat#S7070 |
| UK5099 | Sigma-Aldrich | Cat#PZ0160; CAS 56396-35-1 |
| CB839 | Calithera Biosciences | N/A |
| Gls1 inihibitor III | Millipore | Cat# 533717; CAS 1439399-58-2 |
| Hgp100\/25-33 KVPRNQDWL | (Gattinoni et al., 2009) | N/A |
| Gp100-W vaccinia virus vector | (Overwijk et al., 1998) | N/A |
| 2W peptide EAWGALANWAVDSA | GenScript | N/A |
| Rapamycin | Sigma Aldrich | Cat#553210 |
| GolgiPlug | BD | Cat#555029 |
| PMA | Sigma Aldrich | Cat#P8139 |
| lonomycin | Sigma Aldrich | Cat#IO634 |
| Cell Trace Violet | Invitrogen | Cat#c34557 |
| ACK Lysing Buffer | VWR | Cat#10–548E |
| Cyclophosphamide | Sigma Aldrich | Cat#C0768 |
| Complete Freund’s Adjuvant | Sigma Aldrich | Cat#F5881 |
| Critical Commercial Assays | ||
| Genomic DNA clean & concentrator | Zymo Research | Cat#D4011 |
| Nextera DNA prep kit | Illumina | Cat#FC-121-1030 |
| Nextera index kit | Illumina | Cat#FC-121-1011 |
| CD4+ isolation kit | Miltenyi | Cat#130-104-454 |
| CD8+ isolation kit | Miltenyi | Cat#130-095-236 |
| Pan T cell isolation kit | Miltenyi | Cat#130-095-130 |
| Fix/perm kit | ThermoFisher | Cat#88-8824-00 |
| Fixation/permeabilization kit | BD | Cat#554715 |
| NEBNext High-fidelity 2x PCR mix | New England Biolabs | Cat#M0541 |
| RNeasy Mini Kit | QIAGEN | Cat#:74104 |
| NEBNext Ultra RNA Library Kit | New England Biolabs | Cat#E7530 |
| XF Mito Stress test kit | Agilent | Cat#103015-100 |
| KAPA express Extraction Kit | KAPA | Cat#KK5121 |
| Deposited Data | ||
| RNA Seq data | This paper | GEO: GSE112244; https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE112244 |
| ATAC Seq data | This paper | ArrayExpress: E-MTAB-6648 https://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-6648/ |
| Experimental Models: Cell Lines | ||
| CD19+ Eμ-ALL01 cells (Emu) | (Davila et al., 2013) | N/A |
| Plat-E retroviral packaging cell line | Cell Biolabs | Cat#RV-101 |
| E. Coli LPS | Sigma | Cat#L4391 |
| Dust Mite Antigen | Greer | Cat#XPB70D3A2.5 |
| Experimental Models: Organisms/Strains | ||
| Mouse: GLS KO: GLSfl/fl CD4-CRE mice | This paper | N/A |
| Mouse: pmel Tg mouse: B6.Cg-Thy1a/Cy Tg(TcraTcrb)8Rest/J | (Sukumar et al., 2013) | RRID: IMSR_JAX:005023 |
| Mouse: C57BL6 | Jackson Labs | RRID: IMSR_JAX:000664 |
| Mouse: RAG1 KO | Jackson Labs | RRID: IMSR_JAX:002216 |
| Mouse: CAS9 | Jackson Labs | RRID: IMSR_JAX:024858 |
| Oligonucleotides | ||
| GLS KO Forward ACGAGAAAGTGGAGATCG | This paper | N/A |
| GLS KO reverse GCCTTCTGGAAAACA | This paper | N/A |
| PIK3IP1 guide RNA 1 AGACCGGCGTCCCTGAAAAG | This paper | N/A |
| PIK3IP1 guide RNA 2 TCGTGGGCTACACTTACAAG | This paper | N/A |
| Recombinant DNA | ||
| Plasmid MSCV-IRES-Thy1.1 | (Wu et al., 2006) | Addgene Cat#17442 |
| Plasmid MSCV-Pik3ip1-IRES-Thy1.1 | (Wei etal., 2016) | N/A |
| Plasmid pMx-U6-empty-GFP | (Toffalini et al., 2009) | N/A |
| Plasmid pMx-U6-PIK3IP1gRNA1-GFP | This paper | N/A |
| Plasmid pMx-U6-PIK3IP1gRNA2-GFP | This paper | N/A |
| Software and Algorithms | ||
| Flowjo version V10 | Flowjo | https://www.flowjo.com; RRID: SCRJD08520 |
| GraphPad Prism v6.0 | GraphPad Software | https://www.graphpad.com; RRID: SCR_002798 |
| R statistical software | R Foundation | https://www.r-project.org/ |
| STAR software | (Mudge and Harrow, 2015) | https://github.com/alexdobin/STAR |
| SAMtools | (Li et al., 2009) | http://samtools.sourceforge.net/ |
| featureCounts | (Liao etal., 2014) | http://subread.sourceforge.net/ |
| DESeq2 Sequencing software | (Love etal., 2014) | N/A |