Skip to main content
NCBI home page
Philosophical Transactions of the Royal Society B: Biological Sciences logoLink to Philosophical Transactions of the Royal Society B: Biological Sciences
. 2019 Jan 14;374(1767):20180308. doi: 10.1098/rstb.2018.0308

A nucleotide-binding site-leucine-rich repeat receptor pair confers broad-spectrum disease resistance through physical association in rice

Zhen Xie 1,2,†, Bingxiao Yan 1,3,†, Jianyao Shou 4,†, Jun Tang 1, Xin Wang 1, Keran Zhai 1, Jiyun Liu 1, Qun Li 1, Meizhong Luo 5, Yiwen Deng 1,‡,✉, Zuhua He 1,2,‡,✉
PMCID: PMC6367147  PMID: 30967012

Abstract

Rice blast caused by Magnaporthe oryzae is the most destructive fungal disease in crops, greatly threatening rice production and food security worldwide. The identification and utilization of broad-spectrum resistance genes are considered to be the most economic and effective method to control the disease. In the past decade, many blast resistance (R) genes have been identified, which mainly encode nucleotide-binding leucine-rich repeat (NLR) receptor family and confer limited race-specific resistance to the fungal pathogen. Resistance genes conferring broad-spectrum blast resistance are still largely lacking. In this study, we carried out a map-based cloning of the new blast R locus Pizh in variety ZH11. A bacterial artificial chromosome (BAC) clone of 165 kb spanning the Pizh locus was sequenced and identified 9 NLR genes, among which only Pizh-1 and Pizh-2 were expressed. Genetic complementation experiments indicated that Pizh-1 but not Pizh-2 alone could confer blast resistance. Intriguingly, both mutations on Pizh-1 and Pizh-2 by CRISPR-Cas9 abolished the Pizh-mediated resistance. We also observed that Pizh-1-mediated resistance was partially dependent on Pizh-2. Pizh-1 and Pizh-2 form a complex of NLRs through direct interaction. This suggests that Pizh-1 may function as the executor NLR and Pizh-2 as a ‘helper’ NLR that shares functional redundancy with other NLRs. Our current study provides not only a good tool for rice disease resistance breeding but also deep insight into NLR association and function in plant immunity.

This article is part of the theme issue ‘Biotic signalling sheds light on smart pest management’.

Keywords: broad-spectrum resistance, rice blast, nucleotide-binding site-leucine-rich repeat receptor, gene cloning

1. Introduction

Rice blast, caused by Magnaporthe oryzae/Pyricularia oryzae (M. oryzae) is the most destructive disease in rice, usually causes 10–30% yield loss in epidemic areas [1,2], which greatly threatens rice production and food security worldwide. The identification and utilization of broad-spectrum resistance genes have been thought as the most economic and effective way to control rice blast [3]. To date, over 100 blast resistance (R) genes (Pi) have been identified, which are distributed on 11 rice chromosomes except chromosome 3. At least 28 Pi genes have been cloned. Most of them encode NLR receptors, except Pi-d2, pi21 and Ptr [4–24]. Pi-d2 encodes a receptor-like kinase protein with a predicted extracellular domain of a bulb-type mannose-specific binding lectin (B-lectin) and an intracellular serine-threonine kinase domain [21]. Pi21 encodes a proline-rich protein that contains a putative heavy metal-binding domain and protein–protein interaction motifs. The resistant allele pi21 carries deletions in the proline-rich motif and reduces blast infection rate [13]. Ptr is an atypical resistance gene encoding a protein with four Armadillo repeats. Ptr is required for broad-spectrum blast resistance mediated by the NLR gene Pi-ta and by Pi-ta2 [22]. However, Pi genes that confer breeding-approved broad-spectrum blast resistance are still rare and the mechanisms underlying broad-spectrum are still elusive.

Interestingly, several Pi loci including Pik, Pikm, Pikp, Pi5 and Pia, which are all present in a head-to-head orientation and separated by short noncoding regions, each require two independent NLR genes for the blast resistance [9,11,16,17,25], which are all present in a head-to-head orientation and separated by short non-coding regions. The Pik pair comprises Pik-1 (the sensor) and Pik-2 (the executor). This Pik pair recognizes the M. oryzae effector AVR-Pik that directly binds to an integrated heavy metal-associated (HMA) domain, localized between the coiled-coil (CC) and the nucleotide-binding site (NBS) of Pik-1, releasing Pik-2 to activate immune signalling. Both the AVR-Pik effectors and the Pik NLRs exist as an allelic series in M. oryzae and rice, respectively, indicating that they most probably arose through coevolution [26]. Similarly, the Pia locus also contains two NLR proteins RGA4 and RGA5 that physically interact with each other; the RATX1 domain of RGA5 acts as a receptor for binding with effectors AVR1-CO39 and AVR-Pia, which disrupt the complex of RGA5 and RGA4, releasing RGA4 to activate downstream of immune signalling [25]. In addition, Pi5-mediated resistance to rice blast is also conferred by a pair of NLRs, Pi5-1 and Pi5-2 [11]. However, these NLRs, when expressed alone, do not confer resistance against M. oryzae isolates.

Only a few R loci conferring resistance to multiple blast races/isolates have been identified, including Pigm, Pi9, Pi2/Pizt, Pi5, Pb1, Ptr [8,11,14,22,24,27]. Among the Pi loci, Pigm, Pi9 and Pi2/Pizt are genetically allelic with different functional NLR genes [27,28]. The Pigm locus provides the broadest spectrum for blast resistance discovered so far. Interestingly, the locus contains a cluster of 13 NLR genes. Among the NLRs encoded, a single NLR, PigmR, confers broad-spectrum resistance, whereas another NLR, PigmS, confers susceptibility, which competitively forms a heterodimer with PigmR and suppresses the PigmR-mediated resistance, strongly supporting the notion that NLR self-association is critical to NLR activation, and thereby immune responses; however, the molecular mechanism of the PigmR/PigmS complex in immune activation is obviously different from those of RGA4/RGA5 and Pik-1/Pik-2 [27].

In this study, we identify a new broad-spectrum Pi locus through map-based cloning of Pizh, from the Japonica/Geng variety Zhonghua11 (ZH11), which shows good performance in a continuous test of natural blast nursery. We show that Pizh contains a pair of NLR proteins that coordinate the broad-spectrum blast resistance through physical association. Introduction of Pizh into the elite rice cultivar, Kongyu131, by maker-assisted selection, greatly enhanced blast resistance to different M. oryzae isolates, demonstrating its good potential in breeding new varieties with broad-spectrum blast resistance.

2. Methods

(a). Plant materials

Seven rice cultivars, ZH11, Gumei4 (Pigm), C101A51(Pi2), 75-1-127 (Pi9), CO39 and Dongxiang (DX), were used in this study. The F1 and F2 populations derived from a cross between ZH11 and highly susceptible cultivar DX were generated for genetic and mapping analysis.

(b). Blast inoculation and disease evaluation

A total of 31 M. oryzae isolates were used in the study as listed in electronic supplementary material, table S1. Two-week-old seedlings were spray-inoculated with M. oryzae spore suspensions (1.5 × 105 spores ml−1) as previously described [28]. Briefly, inoculated seedlings were kept in darkness at 25°C–27°C and over 90% relative humidity for 24 h, followed by growing under a 12/12 (day/night) photoperiod with the same temperature and relative humidity. To analyse the field resistance response of the same individuals to different isolates, the inject-inoculation method was employed at the tillering stage: each tiller of the same individuals was inoculated with one isolate by injecting 0.1 ml spore suspensions (2.5 × 104 spores ml−1). After 7 days, disease symptoms were scored according to the 0–5 scoring system described by Bonman et al. [29]. For punch inoculated with pierced leaves as previously described by Wang et al. [30], briefly, leaf segments (5–6 cm long) from the top full-expanded leaf were pierced with a needle, and a droplet of spore suspension (10 μl containing approximately 50 spores) was inoculated on the punctured sites. Inoculated leaves were kept in a growth chamber with 12 h day/12 h night at 26°C. Disease symptoms were recorded at 5 and 7 days after inoculation. Disease symptoms were evaluated at 7 dpi by calculating lesion areas/lengths of fifteen infected leaves using the software ImageJ or a ruler, and measuring relative fungal growth by DNA-based quantitative PCR, as previously reported [27].

(c) Mapping of Pizh

A PCR-based mapping approach was performed: briefly, the F2 population from the cross of ZH11 × DX was inoculated with the M. oryzae isolate 85–14, which is avirulent to ZH11 and virulent to DX. Inheritance of blast resistance of ZH11 was analysed based on the separate ratio of resistant and susceptible individuals. A total of 180 simple sequence repeat (SSR) and InDel markers, evenly distributed on 12 chromosomes, were screened for polymorphisms between the parents as previously described [28,31]. The polymorphic markers were then subjected to a modified bulked segregate analysis combined with recessive class analysis [32], using genomic DNAs of the two parents, 20 highly susceptible and 20 resistant individuals for linkage analysis and chromosome location of the Pizh locus. An additional 1500 susceptible F2 individuals were further analysed to finely map the Pizh locus.

(d). Screening and sequencing of the candidate bacterial artificial chromosome (BAC) clone of Pizh

The genomic BAC library of ZH11 was constructed using the method as previously described [33]. The markers tightly linked to Pizh were used for screening of candidate BAC clones. The contig map spanning the Pizh locus was constructed based on end-sequencing of candidate BAC clones. The BAC clone 81G2 was selected and further completely sequenced by shot-gun technique using an ABI 3730 sequencer. The genomic sequence of the Pizh locus was annotated using the gene prediction program Fgenesh (www.softberry.com) and was manually edited by a homology search against available databases on GenBank (www.ncbi.nlm.nih.gov/genbank).

(e). RNA preparation and quantitative RT-PCR (qPCR) analysis

Total RNAs were extracted from different rice tissues using TRIzol reagent and treated with RNase-free DNase I according to the manufacturer's protocol (Invitrogen). The resulting RNAs were reverse-transcribed using the Superscript III RT kit (Invitrogen). The expression of resistant genes Pizh-1 and Pizh-2 was analysed using qRT-PCR, which was performed using SYBR Green (Takara) with the Eppendorf AG 22331 cycler following the manufacturer's instructions. Each qRT-PCR assay was replicated technically three times, and the rice OsActin1 gene (LOC_Os03g50885) was used as an internal control. The primers for qRT-PCR are listed in electronic supplementary material, table S3.

(f). Plasmid construction and rice transformation

To generate the constructs for complementation test, the entire coding regions (CDS) of Pizh-1 and Pizh-2 were amplified using gene-specific primers from cDNA derived from total RNAs of ZH11, and the PCR products were inserted into the binary vector pCAMBIA1300- CaMV35S to generate overexpression plasmids 35S::Pizh-1, 35S::Pizh-2, sequencing to confirm the inserts. The expression constructs were introduced into the susceptible variety Nipponbare (NIPB) via Agrobacterium-mediated transformation to generate more than 30 independent transgenic plants for each construct, which were selected by PCR-based gene expression assays and resistance evaluation.

We used the CRISPR/Cas9 system to create Pizh-1 and Pizh-2 knockout (KO) mutants. The CRISPR/Cas9 binary vectors were constructed as previously described [34]. The Cas9 plant expression vector (pYLCRISPR/Cas9Pubi-H) and sgRNA expression vector (pYLgRNA) were kindly provided by the Yao-Guang Liu laboratory (South China Agricultural University). We selected the target of Pizh-1 (CGACGAGACCAGCCTCCTGC), the target 2 (TGAAACTTAGAGAGCGCCAC) in the exon of Pizh-2 and the target 3 (CTAGAAATAAACCCAAGCC) in both exons of Pizh-1 and Pizh-2 as candidate target sequences. The constructs were introduced into ZH11 to generate more than 30 independent transgenic plants for each construct by the Agrobacterium-mediated transformation procedure as described previously [35]. To identify CRISPR KO mutations, regions surrounding the target sites were amplified using gene-specific primers of Pizh-1 and Pizh-2 as listed in electronic supplementary material, table S3 and were sequenced to confirm mutations.

(g). Split luciferase complementation assay

For split luciferase complementation assay constructs, the full-length open-reading sequences of Pizh-1 and Pizh-2 were inserted into the vector pCAMBIA-35S-NLuc and pCAMBIA-35S-CLuc to generate expression plasmids, CLuc-Pizh-1, CLuc-Pizh-2, Pizh-1-NLuc and Pizh-2-NLuc. Transient expression in Nicotiana benthamiana leaves and split luciferase complementation assay were performed as described [36].

(h). Yeast two-hybrid assay

The full-length open-reading sequences of Pizh-1 and Pizh-2 were inserted into the vectors pDEST22 and pDEST32 by the Gateway cloning technology (Invitrogen), respectively, using the gene-specific primers (electronic supplementary material, table S3). The resulting constructs were transformed into yeast strain AH109. Co-transformants were plated on synthetic medium lacking uracil, tryptophan, leucine and histidine, and incubated at 28°C for 3 days. Experimental procedures for Y2H followed the manufacturer's instructions (Invitrogen).

(i). Phylogenetic analysis

We collected protein sequences of relative rice NLR Pi genes. The NLR sequences were aligned with the Clustalx program. An unrooted phylogenetic tree was constructed using MEGA5 software with 1000 bootstrap replications [37].

3. Results

(a). ZH11 displays a resistance spectrum different from those conferred by Pi9, Pi2 and Pigm

To evaluate the blast response spectrum of ZH11, we used a total of 31 representative M. oryzae isolates from different regions (electronic supplementary material, table S1). Three known broad-spectrum resistant cultivars, Gumei4 carrying Pigm, 75-1-127 carrying Pi9 and C101A51 carrying Pi2, were used as resistance controls, and the highly susceptible cultivar CO39 was used as a susceptible control. To our surprise, ZH11 was highly resistant to all isolates but one, TH12 (figure 1b or electronic supplementary material, table S1). Gumei4 (Pigm) was resistant to all the isolates tested, as previously reported [27,28]. By contrast, C101A51 (Pi2) was susceptible to eight isolates, and 75-1-127 (Pi9) was susceptible to five isolates. We evaluated field resistance performance of ZH11 in the natural blast nursery (Donghui, Zhejiang) from 2013 to 2018. The continuous field trial showed that ZH11 indeed displayed high broad-spectrum resistance to blast (figure 1b). Therefore, we conclude that that ZH11 also confers broad-spectrum resistance to M. oryzae, with a resistance spectrum different from known Pi9/Pi2/Pigm.

Figure 1.

Figure 1.

Open in a new tab

The rice variety ZH11 exhibits broad-spectrum resistance against M. oryzae. (a) Resistance phenotype of variety ZH11 (Pizh) was recognized by spray-inoculation with one representative blast isolate in two-week-old seedlings; CO39 served as a susceptible control. Bar, 1 cm. (b) Field disease resistance of ZH11 and CO39 grown in the natural blast nursery, showing that CO39 was almost killed by M. oryzae, while ZH11 stood completely heathy.

(b). A single dominant locus on chromosome 6 controls broad-spectrum blast resistance in ZH11

Two different M. oryzae isolates, 85–14 and 01–19, were used for genetic analysis of the blast resistance in ZH11, using the F1 and F2 population derived from a cross between ZH11 and DX. All the F1 plants were resistant to 85–14 and 01–19, indicating that the dominant inheritance of the R gene(s) in ZH11. The segregation of resistant and susceptible individuals in the F2 population fitted a ratio of 3: 1 (379 resistant: 104 susceptible), suggesting that the resistance to 85–14 and 01–19 is controlled by a single dominant R gene in ZH11. We designated this R gene in ZH11 as Pizh.

We performed map-based cloning to identify Pizh. First, a total of 180 SSR and InDel markers distributing evenly on 12 chromosomes were used in bulked segregate analysis (BSA). We found that two polymorphic markers, RM6836 and RM3183 on chromosome 6 (figure 2a), were associated with Pizh. Further, we confirmed the linkage relationship between RM6836, RM3183 and Pizh by analysing the polymorphism of RM6836 and RM3183 in each of 30 resistant and susceptible homozygous individuals confirmed in F3 progeny, indicating that the RM6836 and RM3183 polymorphism was associated with the Pizh locus.

Figure 2.

Figure 2.

Open in a new tab

Physical mapping of Pizh in a 165 kb region on chrosome 6. (a) Preliminary mapping of Pizh in the interval between the markers RM19814 and RM19819 on chrosome 6. (b) Fine mapping of Pizh in a region co-segregating with the markers Indel3 and Indel4, within a contig spanning the Pizh locus including three BAC clones that were derived from ZH11 and were end-sequenced. Numbers in parentheses indicate recombinants between markers. (c) Sequencing of the BAC clone 81G2 reveals a cluster of 9 NLR genes in the Pizh locus.

Based on the linkage of Pizh with the markers, we further screened the 1500 susceptible/recessive individuals identified from the F2 population, which were confirmed in F3 progeny by inoculating with isolate 85–14. The location of Pizh was then narrowed down to a small region on chromosome 6 using a set of SSR and InDel markers between RM6836 and RM3183 according to the genomic sequences of Nipponbare (Japonica/Geng) and the indica 9311 (Indica/Xian) (electronic supplementary material, table S3). The Pizh locus was delimited by the flanking markers Indel2 and Indel5, with three and two recombinant events detected, respectively; and co-segregated with the markers Indel3 and Indel4. Therefore, Pizh was finally locked within an 80 kb region between the two makers Indel2 and Indel5 on the reference genome of Nipponbare, a region where Pigm/Pi9/Pi2 also nest [24,27,28,38]. Therefore, Pizh is a novel allele of Pigm/Pi9/Pi2.

(c). Genomic sequence and gene annotation of the Pizh locus

To obtain sequence information of the Pizh locus, we constructed a genomic BAC library of ZH11 with an average insert size of 140 kb [39]. The co-segregated markers Indel3 and Indel4 were used for PCR screening of the BAC library. Three positive clones were identified and end-sequenced to confirm whether these BAC clones overlapped. A contig map consisting of three overlapping ZH11 BAC clones was constructed that covered the Pizh locus (figure 2b).

We sequenced the BAC clone 81G2 containing the entire Pizh locus using shot-gun strategy, and a total 165 kb region spanning the Pizh was assembled. Gene annotation was performed using a BLAST search against the public databases and Fgenesh program (www.softberry.com). There are nine NLR type R genes in the Pizh locus (figure 2c), including two intact genes (R2, R4), seven pseudogenes or truncated genes (R1, R3 and R5 to R9). We determined the expression and transcripts of the candidate genes by RT-PCR, and found that R2 (designated as Pizh-2) and R4 (designated as Pizh-1) were expressed, with entire CDS encoding 1032 and 1033 amino acids, respectively. Both Pizh-1 and Pizh-2 belong to the family of typical CC-nucleotide-binding leucine-rich repeat receptor proteins (figure 3; electronic supplementary material, figure S1).

Figure 3.

Figure 3.

Open in a new tab

Genomic structure of Pizh-1 and its amino acid sequence. (a) Gene structure of Pizh-1. The black box represents exon, lines denote introns, and grey boxes indicate 5′- and 3′-untranslated regions (UTR). (b) Amino acid sequence of the Pizh-1 gene product. The two coiled-coil (CC) motifs are underlined. The conserved motifs (P-loop, Kinase2, RNBS-B, GLPL, RNBS-D, MHD) in the nucleotide-binding site (NBS) region are indicated. The C-terminal leucine-rich repeat (LRR) domain consists of 17 imperfect LRR repeats with the consensus IXX(L)XX(L)XX(L).

Most rice Pi genes are constitutively expressed, except for Pib, Pi5-1, Pik-m and Pik-p, which exhibit a pathogen-induced expression pattern [4,9,11,17]. To determine whether Pizh can be induced during infection by M. oryzae, we analysed the induction of Pizh-1 in infected ZH11 leaves in a time course (0 ∼ 72 h post inoculation [hpi]). Expression of Pizh-1 was not changed by pathogen challenge, indicating that this gene is constitutively expressed. By contrast, Pizh-2 was slightly induced at 48 hpi, but inhibited at 72 hpi (electronic supplementary material, figure S2). Therefore, Pizh-1 and Pizh-2 likely display subtle differences in response to pathogen. Phylogenetic analysis of Pizh and other known NLR proteins in rice revealed that these NLRs could be classified into nine phylogenetic clades (Clades A to I), of which allelic Pizh, Pi2, Pizt, PigmR, Pi50 and Pi9 were grouped in the same sub-group of Clade A (electronic supplementary material, figures S3 and S4). Interestingly, Pizh-1 shares the same protein sequence with Pizt, suggesting their same origin. For consistency in context, we still keep Pizh-1 hereafter. But ZH11 exhibits a broader blast-resistance spectrum than Toride I (Pizt) dependent on our previous field resistance evaluation and inoculation result, which indicates that additional resistant genes are also harboured in ZH11, except for Pizh.

(d). Pizh-1 and Pizh-2 coordinately confer broad-spectrum blast resistance

To determine which one of the candidate genes (Pizh-1 and Pizh-2) is responsible for the Pizh-mediated resistance to M. oryzae, we developed transgenic plants constitutively expressing Pizh-1 and Pizh-2 driven by the 35S promoter in the susceptible Nipponbare (NIPB) background. The transgene plants expressing Pizh-1 but not Pizh-2 were resistant to all isolates tested (figure 4a–e; electronic supplementary material, table S2).

Figure 4.

Figure 4.

Open in a new tab

Functional identification of the Pizh candidate gene. (a) Resistance phenotype of representative transgenic plants expressing Pizh-1 and Pizh-2. Two-month-old adult plants grown in the field were injection-inoculated with isolate 85–14, showing that Pizh-1 but not Pizh-2 confers blast resistance. The gene donor ZH11 and the wild-type NIPB served as resistant and susceptible controls, respectively. (b) Gene expression of Pizh-1 and Pizh-2 was detected using qRT-PCR in the transgenic lines and wild-type NIBP. (c,g) Lesion area of infected leaves was measured at 7 dpi with the ImageJ software. (d,f) The relative fungal growth was measured at 7 dpi using the calculation MoPot2/OsUbq. (e) Resistance phenotype of the transgenic lines gene expression of Pizh-1 and Pizh-2 was detected using qRT-PCR in pizh-1 single and pizh-1/pizh-2 double mutants in the ZH11 background. One-month-old seedlings were punch-inoculated with isolates 85–14, indicating that pizh-1 partially but pizh-1/pizh-2 completely lost blast resistance, compared with the wild-type ZH11. A Student's t-test was used to analyse the significance of the difference (*p < 0.05, **p < 0.01, n.s.: not significant) (c,d,g,f).

We also developed KO mutants of Pizh-1 and Pizh-2 using the CRISPR/cas9 genome-editing method in the ZH11 background. We only obtained pizh-1 single and pizh-1/pizh-2 double KO mutants (electronic supplementary material, figure S5), but no pizh-2 single KO mutant after extensive screening. Magnaporthe oryzae inoculation revealed that, as expected, the pizh-1 KO mutants exhibited susceptible phenotype (figure 4e–g). Interestingly, the pizh-1/pizh-2 double mutant plants were shown to be more susceptible than the pizh-1 single mutants (figure 4e–g). Taken together, these results demonstrate that Pizh-1 confers broad-spectrum blast resistance in the Pizh locus, and Pizh-2 alone does not confer blast function. We suggest that Pizh-2 may act as a ‘helper’ NLR functioning coordinately with Pizh-1, its loss-of-function impairing the disease resistance mediated by Pizh-1.

(e). Pizh-1 interacts physically with Pizh-2 to form hetero-complex

The functionality of Pizh-1 and Pizh-2 described above allowed us to speculate that Pizh-2 may function through direct interaction with Pizh-1 to form an NLR immune complex. To test this hypothesis, we first detected the interaction between Pizh-1 and Pizh-2 in a yeast two-hybrid (Y2H) assay (figure 5a). Furthermore, we performed a split luciferase complementation assay to determine the Pizh-1 and Pizh-2 interaction in planta (figure 5b). Therefore, Pizh-1 and Pizh-2 form a functional NLR pair that confers broad-spectrum blast resistance. Given the fact that the transgenic NIPB plants expressing Pizh-1 alone developed broad-spectrum blast resistance (figure 4a), we consider that an unrecognized NLR(s) likely acts as a ‘helper’ of Pizh-1 in the NIPB genome, ensuring the Pizh-1-triggered immunity.

Figure 5.

Figure 5.

Open in a new tab

Pizh-1 physically interacts with Pizh-2. (a) Pizh-1 interacts with Pizh-2 in a yeast two-hybrid assay. Dilution series of yeast cells expressing GAL4-AD and GAL4-BD fusions of Pizh-1 or Pizh-2 full-length proteins on non-selective synthetic medium lacking Trp and Leu (-Leu-Trp) and selective medium additionally lacking His (-Leu-Trp-His). (b) Split luciferase complementation assay indicates in planta interaction between Pizh-1 and Pizh-2, reconstructing the luciferase signal with the pairs of Pizh-1-NLuc and CLuc-Pizh-2, Pizh-2-NLuc and CLuc-Pizh-1. Fluorescence signal intensity is indicated.

(f). Molecular breeding application of Pizh elite rice varieties

To develop a practical marker for application of Pizh in molecular breeding in rice, we first performed sequence comparison of the Pizh alleles between resistant variety ZH11 and the susceptible varieties NIPB, 9311 and CO39, and revealed that the Pizh-1(R4) is absent in the genome of NIPB, 9311 and CO39. Based on this, we designed a specific marker, M262, in the intron of Pizh-1, and used this to genotype the representative resistant and susceptible varieties. We found that this maker could precisely distinguish the Pizh locus from different susceptible alleles (figure 6a,b). Therefore, M262 can be efficiently used as a Pizh-specific marker in rice molecular breeding for blast resistance. Using a backcross approach, we have successfully introduced Pizh into the high-quality but blast-susceptible variety Kongyu131. The improved new line, KY131-Pizh, exhibited high blast resistance in inoculation assay (figure 6c), which will be further tested in natural blast nurseries to determine its field performance.

Figure 6.

Figure 6.

Open in a new tab

Molecular breeding application of Pizh in elite rice improvement. (a) Design of a Pizh-specific marker that can efficiently detect the genotype of rice cultivars. 1, susceptible variety Nipponbare; 2, resistant variety ZH11 (Pizh); 3, resistant variety TorideI (Pizt); 4 to 16, susceptible varieties: 9311, CO39, Zhenshan97, Minghui63, Kasalath, Kongyu131, TN1, TP309, Minghui86, Teqing, Longtepu, Wuyujing8, Huanghuazan. (b) Genotyping of progeny plants in the breeding population derived from the cross between cultivar ZH11 and Kongyu131 (KY131). R, resistant; S, susceptible. (c) Enhance blast resistance of the improved Kongyu131 lines with the Pizh locus (KY131-Pizh) through backcross and maker assistant selection approaches.

4. Discussion

The utilization of host R genes has long been practised in crop breeding for disease resistance in crops. However, disease resistance breeding rarely succeeds because of the lack of elite broad-spectrum disease resistance genes, particularly in rice breeding for blast resistance because this fungal pathogen prevails in all rice areas worldwide. In this study, we identify a novel blast resistance locus, Pizh, from a widely-cultivated rice variety Zhonghua 11, which was bred from resistant varieties Jingfeng5, Tetep and Fukunishiki in 1984, exhibiting a broad-spectrum and durable field resistance against M.oryzae for 30 years in Northern China. Interestingly, Pizh is allelic to Pigm/Pi2/Pi9 but with a different resistance spectrum, providing a new molecular tool for improving rice blast resistance.

Interestingly, at least eight Pi genes/loci have been identified in this Pigm NLR cluster; each allelic cluster contains different NLR gene members and functional NLR(s), resulting in different spectrum resistance against M. oryzae. Therefore, this region is a hot spot of R gene origin and evolution owing to frequent gene duplication, uneven crossing over or transposon insertion [27]. It is possible that Pizh evolved independently of Pigm/Pi9/Pi2, given that Pizh-1 does not share high sequence similarity to other allelic NLRs (electronic supplementary material, figure S3a). Other biological or ecological impacts of these alleles outside their function in disease resistance will be worthy of further investigation.

Recent data suggest a hypothesis that two adjacently located NLRs often work as a pair in the execution of immune action upon pathogen recognition. Among these NLR pairs, a ‘sensor’ NLR is responsible for pathogen perception and an ‘executor’ or ‘helper’ NLR is responsible for activation of downstream signalling. There are two generic models emerging [40]. In the ‘sensor–executor model’, the two NLRs are encoded by one locus and the NLR proteins physically interact with each other. In this model, the ‘sensor’ NLR carries an integrated domain that mimics the effector-target and aids pathogen perception. Effector perception by the sensor NLR relieves the suppression of the ‘executor’ NLR, launching downstream immunity signalling. This is the case for the rice RGA5/RGA4 and Arabidopsis RRS1/RPS4 pairs [25,41]. The second model is named ‘the sensor–helper model’ based on the fact that ‘helper’ NLRs function downstream of multiple ‘sensor’ NLRs. In this case, the two NLRs are typically encoded by different loci. Several ‘helper’ NLRs have been identified in diverse plant species, including to Solanaceae NRC1, tobacco NRG1 and Arabidopsis ADR1 [42–44], and the ‘helper’ NLRs merely require activation by the ‘sensor’ NLRs, rather than de-repression. In our current study, Pizh-1 itself confers broad-spectrum blast resistance, while Pizh-2 likely acts as a ‘helper’ NLR contributing to Pizh-1-mediated resistance against M. oryzae. Therefore, the Pizh-1/Pizh-2 pair is mechanistically different from the RGA4/RGA5 NLR pair, in which neither NLR can confer resistance on its own [25]. The Pizh-1/Pizh-2 complex is also distinct from the PigmR/PigmS complex functionally and mechanistically [27]. This function mode difference further strengthens the notion that this hot NLR spot could evolve independently and sub-functionalize either in functional NLRs or NLR pairing different alleles. Therefore, our current study also provides new insights into NLR interaction and function in plant immunity, in addition to an important new genetic tool for molecular breeding in crop improvement.

5. Conclusion

This study identifies a new broad-spectrum blast resistance locus, Pizh, in rice. In the locus, two NLR receptors, Pizh-1 and Pizh-2, coordinately control disease resistance through physical interaction to form a hetero-complex for immune activation. We suggest that Pizh-1 likely functions as the ‘executor’ NLR and Pizh-2 as a ‘helper’ NLR. Our study provides a new example of plant NLR pairs performing a resistance function. More importantly, the Pizh locus shows good potential in molecular breeding for blast resistance improvement in rice.

Supplementary Material

Supplementary material
rstb20180308supp1.pdf (951.9KB, pdf)

Acknowledgements

We thank for Q. Feng and B. Han for sequencing BAC clones. S. Wu, R. Chai, G. Pan helped us with blast nursery tests.

Data accessibility

The genomic sequence of the Pizh locus was deposited in GenBank under accession no. MH807580.

Authors' contributions

Y.D. and Z.H. designed experiments; Z.X., B.Y., J.S., J.T., X.W., K.Z., J.L., Q.L., M.L., Y.D. and Z.H. performed experiments and data analysis. Y.D. and Z.H. wrote the manuscript. All authors have read, edited and approved the content of the manuscript.

Competing interests

We have no conflict of competing interests.

Funding

This project was supported by grants from the Ministry of Science and Technology of China (2016YFD0100600), the Chinese Academy of Sciences (XDA08010201-1) and National Natural Science Foundation of China (31720103913, 31772149).

References

  • 1.Talbot NJ. 2003. On the trail of a cereal killer: exploring the biology of Magnaporthe grisea. Annu. Rev. Microbiol. 57, 177–202. ( 10.1146/annurev.micro.57.030502.090957) [DOI] [PubMed] [Google Scholar]
  • 2.Skamnioti P, Gurr SJ. 2009. Against the grain: safeguarding rice from rice blast disease. Trends Biotechnol. 27, 141–150. ( 10.1016/j.tibtech.2008.12.002) [DOI] [PubMed] [Google Scholar]
  • 3.Khush GS, Jena KK. 2009. Current status and future prospects for research on blast resistance in rice (Oryza sativa L.). In Advances in genetics, genomics and control of rice blast disease (eds GL Wang, B Valent), pp. 1–10. Dordrecht, The Netherlands: Springer.
  • 4.Wang ZX, Yano M, Yamanouchi U, Iwamoto M, Monna L, Hayasaka H, Katayose Y, Sasaki T. 1999. The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes. Plant J. 19, 55–64. ( 10.1046/j.1365-313X.1999.00498.x) [DOI] [PubMed] [Google Scholar]
  • 5.Bryan GT, et al. 2000. A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pi-ta. Plant Cell 12, 2033–2046. ( 10.1105/tpc.12.11.2033) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Liu X, Lin F, Wang L, Pan Q. 2007. The in silico map-based cloning of Pi36, a rice coiled-coil nucleotide-binding site leucine-rich repeat gene that confers race-specific resistance to the blast fungus. Genetics 176, 2541–2549. ( 10.1534/genetics.107.075465) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lin F, Chen S, Que Z, Wang L, Liu X, Pan Q. 2007. The blast resistance gene pi37 encodes a nucleotide binding site leucine-rich repeat protein and is a member of a resistance gene cluster on rice chromosome 1. Genetics 177, 1871–1880. ( 10.1534/genetics.107.080648) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Zhou B, Dolan M, Sakai H, Wang GL. 2007. The genomic dynamics and evolutionary mechanism of the Pi2/9 locus in rice. Mol. Plant Microbe Interact. 20, 63–71. ( 10.1094/MPMI-20-0063) [DOI] [PubMed] [Google Scholar]
  • 9.Ashikawa I, Hayashi N, Yamane H, Kanamori H, Wu J, Matsumoto T, Ono K, Yano M. 2008. Two adjacent nucleotide-binding site-leucine-rich repeat class genes are required to confer Pikm-specific rice blast resistance. Genetics 180, 2267–2276. ( 10.1534/genetics.108.095034) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hayashi K, Yoshida H. 2009. Refunctionalization of the ancient rice blast disease resistance gene Pit by the recruitment of a retrotransposon as a promoter. Plant J. 57, 413–425. ( 10.1111/j.1365-313X.2008.03694.x) [DOI] [PubMed] [Google Scholar]
  • 11.Lee S-K, et al. 2009. Rice Pi5-mediated resistance to Magnaporthe oryzae requires the presence of two coiled-coil-nucleotide-binding-leucine-rich repeat genes. Genetics 181, 1627–1638. ( 10.1534/genetics.108.099226) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Shang J, et al. 2009. Identification of a new rice blast resistance gene, Pid3, by genomewide comparison of paired nucleotide-binding site-leucine-rich repeat genes and their pseudogene alleles between the two sequenced rice genomes. Genetics 182, 1303–1311. ( 10.1534/genetics.109.102871) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fukuoka S, et al. 2009. Loss of function of a proline-containing protein confers durable disease resistance in rice. Science 325, 998–1001. ( 10.1126/science.1175550) [DOI] [PubMed] [Google Scholar]
  • 14.Hayashi N, et al. 2010. Durable panicle blast-resistance gene Pb1 encodes an atypical CC-NBS-LRR protein and was generated by acquiring a promoter through local genome duplication. Plant J. 64, 498–510. ( 10.1111/j.1365-313X.2010.04348.x) [DOI] [PubMed] [Google Scholar]
  • 15.Takahashi A, Hayashi N, Miyao A, Hirochika H. 2010. Unique features of the rice blast resistance Pish locus revealed by large scale retrotransposon-tagging. BMC Plant Biol. 10, 175 ( 10.1186/1471-2229-10-175) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Zhai C, Lin F, Dong Z, He X, Yuan B, Zeng X, Wang L, Pan Q. 2011. The isolation and characterization of Pik, a rice blast resistance gene which emerged after rice domestication. New Phytol. 189, 321–334. ( 10.1111/j.1469-8137.2010.03462.x) [DOI] [PubMed] [Google Scholar]
  • 17.Yuan B, Zhai C, Wang W, Zeng X, Xu X, Hu H, Lin F, Wang L, Pan Q. 2011. The Pik-p resistance to Magnaporthe oryzae in rice is mediated by a pair of closely linked CC-NBS-LRR genes. Theor. Appl. Genet. 122, 1017–1028. ( 10.1007/s00122-010-1506-3) [DOI] [PubMed] [Google Scholar]
  • 18.Okuyama Y, et al. 2011. A multifaceted genomics approach allows the isolation of the rice Pia-blast resistance gene consisting of two adjacent NBS-LRR protein genes. Plant J. 66, 467–479. ( 10.1111/j.1365-313X.2011.04502.x) [DOI] [PubMed] [Google Scholar]
  • 19.Tang J, Zhu X, Wang Y, Liu L, Xu B, Li F, Fang J, Chu C. 2011. Semi-dominant mutations in the CC-NB-LRR-type R gene, NLS1, lead to constitutive activation of defense responses in rice. Plant J. 66, 996–1007. ( 10.1111/j.1365-313X.2011.04557.x) [DOI] [PubMed] [Google Scholar]
  • 20.Chen J, Shi Y, Liu W, Chai R, Fu Y, Zhuang J, Wu J. 2011. A Pid3 allele from rice cultivar Gumei2 confers resistance to Magnaporthe oryzae. J. Genet. Genomics 38, 209–216. ( 10.1016/j.jgg.2011.03.010) [DOI] [PubMed] [Google Scholar]
  • 21.Chen X, et al. 2006. A B-lectin receptor kinase gene conferring rice blast resistance. Plant J. 46, 794–804. ( 10.1111/j.1365-313X.2006.02739.x) [DOI] [PubMed] [Google Scholar]
  • 22.Zhao H, et al. 2018. The rice blast resistance gene Ptr encodes an atypical protein required for broad-spectrum disease resistance. Nat. Commun. 9, 2039 ( 10.1038/s41467-018-04369-4) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li W, et al. 2017. A natural allele of a transcription factor in rice confers broad-spectrum blast resistance. Cell 170, 114–126.e115. ( 10.1016/j.cell.2017.06.008) [DOI] [PubMed] [Google Scholar]
  • 24.Qu SH, Liu GF, Zhou B, Bellizzi M, Zeng LR, Dai LY, Han B, Wang GL. 2006. The broad-spectrum blast resistance gene Pi9 encodes a nucleotide-binding site-leucine-rich repeat protein and is a member of a multigene family in rice. Genetics 172, 1901–1914. ( 10.1534/genetics.105.044891) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Cesari S, et al. 2014. The NB-LRR proteins RGA4 and RGA5 interact functionally and physically to confer disease resistance. EMBO J. 33, 1941–1959. ( 10.15252/embj.201487923) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kanzaki H, Yoshida K, Saitoh H, Fujisaki K, Hirabuchi A, Alaux L, Fournier E, Tharreau D, Terauchi R. 2012. Arms race co-evolution of Magnaporthe oryzae AVR-Pik and rice Pik genes driven by their physical interactions. Plant J. 72, 894–907. ( 10.1111/j.1365-313X.2012.05110.x) [DOI] [PubMed] [Google Scholar]
  • 27.Deng Y, et al. 2017. Epigenetic regulation of antagonistic receptors confers rice blast resistance with yield balance. Science 355, 962–965. ( 10.1126/science.aai8898) [DOI] [PubMed] [Google Scholar]
  • 28.Deng Y, Zhu X, Shen Y, He Z. 2006. Genetic characterization and fine mapping of the blast resistance locus Pigm(t) tightly linked to Pi2 and Pi9 in a broad-spectrum resistant Chinese variety. Theor. Appl. Genet. 113, 705–713. ( 10.1007/s00122-006-0338-7) [DOI] [PubMed] [Google Scholar]
  • 29.Bonman JM, Dedios TIV, Khin MM. 1986. Physiological specialization of Pyricularia oryzae in the Philippines. Plant Dis. 70, 767–769. ( 10.1094/PD-70-767) [DOI] [Google Scholar]
  • 30.Wang Y, Gao M, Li Q, Wang L, Wang J, Jeon JS, Qu N, Zhang Y, He Z. 2008. OsRAR1 and OsSGT1 physically interact and function in rice basal disease resistance. Mol. Plant Microbe Interact. 21, 294–303. ( 10.1094/MPMI-21-3-0294) [DOI] [PubMed] [Google Scholar]
  • 31.McCouch SR, et al. 2002. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Res. 9, 199–207. ( 10.1093/dnares/9.6.199) [DOI] [PubMed] [Google Scholar]
  • 32.Michelmore RW, Paran I, Kesseli RV. 1991. Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl Acad. Sci. USA 88, 9828–9832. ( 10.1073/pnas.88.21.9828) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Luo M, Wing RA. 2003. An improved method for plant BAC library construction. Methods Mol. Biol. 236, 3–20. ( 10.1385/1-59259-413-1:3) [DOI] [PubMed] [Google Scholar]
  • 34.Ma X, et al. 2015. A Robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant. 8, 1274–1284. ( 10.1016/j.molp.2015.04.007) [DOI] [PubMed] [Google Scholar]
  • 35.Nishimura A, Aichi I, Matsuoka M. 2006. A protocol for Agrobacterium-mediated transformation in rice. Nat. Protoc. 1, 2796–2802. ( 10.1038/nprot.2006.469) [DOI] [PubMed] [Google Scholar]
  • 36.Chen H, Zou Y, Shang Y, Lin H, Wang Y, Cai R, Tang X, Zhou JM. 2008. Firefly luciferase complementation imaging assay for protein–protein interactions in plants. Plant Physiol. 146, 368–376. ( 10.1104/pp.107.111740) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. ( 10.1093/molbev/msr121) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Liu G, Lu G, Zeng L, Wang GL. 2002. Two broad-spectrum blast resistance genes, Pi9(t) and Pi2(t), are physically linked on rice chromosome 6. Mol. Genet. Genomics. 267, 472–480. ( 10.1007/s00438-002-0677-2) [DOI] [PubMed] [Google Scholar]
  • 39.Lin H, Xia P, Wing RA, Zhang Q, Luo M. 2012. Dynamic intra-japonica subspecies variation and resource application. Mol. Plant. 5, 218–230. ( 10.1093/mp/ssr085) [DOI] [PubMed] [Google Scholar]
  • 40.Kourelis J, van der Hoorn RAL. 2018. Defended to the nines: 25 years of resistance gene cloning identifies nine mechanisms for R protein function. Plant Cell 30, 285–299. ( 10.1105/tpc.17.00579) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Le Roux C, et al. 2015. A receptor pair with an integrated decoy converts pathogen disabling of transcription factors to immunity. Cell 161, 1074–1088. ( 10.1016/j.cell.2015.04.025) [DOI] [PubMed] [Google Scholar]
  • 42.Bonardi V, Tang SJ, Stallmann A, Roberts M, Cherkis K, Dangl JL. 2011. Expanded functions for a family of plant intracellular immune receptors beyond specific recognition of pathogen effectors. Proc. Natl Acad. Sci. USA 108, 16 463–16 468. ( 10.1073/pnas.1113726108) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Peart JR, Mestre P, Lu R, Malcuit I, Baulcombe DC. 2005. NRG1, a CC-NB-LRR protein, together with N, a TIR-NB-LRR protein, mediates resistance against tobacco mosaic virus. Curr. Biol. 15, 968–973. ( 10.1016/j.cub.25005.04.053) [DOI] [PubMed] [Google Scholar]
  • 44.Sueldo DJ, Shimels M, Spiridon LN, Caldararu O, Petrescu AJ, Joosten M, Tameling WIL. 2015. Random mutagenesis of the nucleotide-binding domain of NRC1 (NB-LRR required for hypersensitive response-associated cell death-1), a downstream signalling nucleotide-binding, leucine-rich repeat (NB-LRR) protein, identifies gain-of-function mutations in the nucleotide-binding pocket. New Phytol. 208, 210–223. ( 10.1111/nph.13459) [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary material
rstb20180308supp1.pdf (951.9KB, pdf)

Data Availability Statement

The genomic sequence of the Pizh locus was deposited in GenBank under accession no. MH807580.

Articles from Philosophical Transactions of the Royal Society B: Biological Sciences are provided here courtesy of The Royal Society

RESOURCES