Antibodies |
Pax7; Species: Mouse IgG1 |
Developmental Studies Hybridoma Bank |
Cat# pax7, RRID:AB_528428 |
Pan-Laminin; Species: Rabbit |
Sigma-Aldrich |
Cat# L9393 |
Fluorescein; Species: Goat |
Novus Biologicals |
Cat# NB600–493 |
FLAG M2; Species Mouse IgG1 |
Sigma-Aldrich |
Cat# F1804 |
V5; Species: Mouse IgG2a |
Thermo |
Cat# R960–25 |
Slug (C19G7); Species: Rabbit |
Cell Signaling |
Cat# 9585 |
Chemicals, Peptides, and Recombinant Proteins |
Fluoromount-G |
SouthernBiotech |
Cat# 0100–01 |
Wheat Germ Agglutinin, Alexa Fluor™ 488 Conjugate |
Thermo |
W11261 |
DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) |
Thermo |
D1306 |
Experimental Models: Organisms/Strains |
Gallus gallus |
Sun State Ranch (Monrovia, CA, USA) |
N/A |
Oligonucleotides |
Draxin morpholino w/ 3’Fluorescein: AAGGTGGAAGAAGCTGCCATAATCC |
Hutchins and Bronner, 2018; GeneTools |
N/A |
Standard Control morpholino w/ 3’Fluorescein: CCTCTTACCTCAGTTACAATTTATA |
GeneTools |
N/A |
Snail2 morpholino w/ 3’Fluorescein: TCTTGACCAGGAAGGAGC |
Taneyhill et al., 2007; GeneTools |
N/A |
Nhel-V5-Snail2_F Primer: ATAGCTAGCGCCACCATGGGTAAGCCTATCCCTAAC |
This paper; IDT |
N/A |
Xbal-V5-Snail2_R Primer: ACCTCTAGATCAGTGTGCTACGCAGCAG |
This paper; IDT |
N/A |
Recombinant DNA |
pCI-H2B-RFP |
Betancur et al., 2010 |
N/A |
Draxin-FLAG |
Hutchins and Bronner, 2018 |
N/A |
NC1.1 M3:eGFP |
Simoes-Costa et al., 2012 |
N/A |
pCIG-V5-Snail2-IRES-nls-GFP |
Liu et al., 2013 |
Addgene Plasmid #44282 |
pCIG |
Megason and McMahon, 2002 |
N/A |
NC1.1M3-Snail2 |
This paper |
N/A |
Software and Algorithms |
ImageJ64 |
NIH |
N/A |
Fiji |
Schindelin et al., 2012 |
N/A |
Zen 2 Blue |
Zeiss |
N/A |
Photoshop CC |
Adobe |
N/A |