Table 4.
Alternative splicing events predicted from prp-8 G654E mRNA-Seq analysis
| Genotype | Up 5′SS use str. 1,2, % | |
| Gene & Sequence: T12C9.7; TTTATTTCTG▲GTT△gtgagaatttgttttatagttt | ||
| snrp-27(+); prp-8(+) | 18.65, 18.74 | |
| snrp-27(M141T); prp-8(+) | 97.55, 95.55 | |
| snrp-27(+); prp-8(G654E) | 35.61, 35.83 | |
| snrp-27(+); prp-8(T524S) | 1.41, 1.12 | |
| Gene & Sequence: stip-1; AGGATCAGGCGACATAT G▲ GTGGG△gtgagatcattgaaaa | ||
| snrp-27(+); prp-8(+) | 75.96, 75.74 | |
| snrp-27(M141T); prp-8(+) | 94.46, 95.54 | |
| snrp-27(+); prp-8(G654E) | 92.63, 91.88 | |
| snrp-27(+); prp-8(T524S) | 86.61, 87.07 | |
| Gene & Sequence: spat-2; AACAGCGTT△GTGAGG ATGGCCTTGCAAGAAGGG▲gtgcgggctta | ||
| snrp-27(+); prp-8(+) | 71.76, 72.07 | |
| snrp-27(M141T); prp-8(+) | 45.43, 42.86 | |
| snrp-27(+); prp-8(G654E) | 59.26, 61.84 | |
| snrp-27(+); prp-8(T524S) | 50.34, 51.64 | |
Sequences of the alternative spliced regions. 5′ SSs promoted in prp-8 mutant indicated by a filled triangle, partner 5′ SS indicated by an open triangle. Uppercase are sequences that can be exons; lowercase are always intronic. Below the sequence is quantitation of alternative 5′ splice-site usage by 32P-RT-PCR analysis. Genotypes are indicated. T12C9.7 was identified in the prp-8 G654E library, stip-1 in both prp-8 libraries, and spat-2 in the prp8 T524S library.