Skip to main content
. 2019 Jan 2;7(1):42–49. doi: 10.1093/gastro/goy048

Table 2.

FrxA frameshift and nonsense mutations

Mutation Change Affected codon position No. of strains
MR (n = 48) MS (n = 48)
Frameshift −GATTTGCTGCAAAAAAATACGATCC 13 0 1
Frameshift 7A → 6A 18 19 11
Frameshift −G 20 1 0
Frameshift 4G → 3G 38 1 0
Frameshift −TT 52 0 1
Frameshift +TG 60 1 0
Frameshift −C 70 2 2
Frameshift 6G → 7G 70 1 1
Frameshift 6G → 5G 70 2 0
Frameshift GAC → TAAT 92 1 0
Frameshift −G 106 1 0
Frameshift +TATC 145 1 0
Frameshift −G 168 1 0
Frameshift +A 200 0 1
Nonsense CGA → TGA 13 0 1
Nonsense CGA → TGA 86 0 1
Total 31 19

MR, metronidazole-resistant; MS, metronidazole-susceptible.