Table 2.
Summary of CpG oligonucleotides used in teleost.
| CpG-ODN | Sequence (5′->3′) | Action | Fish |
|---|---|---|---|
| 2722 | GTTGTCGTTTTTTGTCGTT | Induce NF-κB activation and cytokine expressions via TLR21 (99) | Grouper |
| 2727 | GTTGTCGTTTTTTGTGCTT | Induce NF-κB activation and cytokine expressions via TLR21 (99) | Grouper |
| 1668 | TCCATGACGTTCCTGATGCT | Activate innate and adaptive immune responses, and offer protection from bream iridovirus infection (100, 101) Used as an adjuvant for vaccines against V. harveyi infection (102) Activate innate immune response and upregulate TLR9 and IgM-mediated immune response (103) Increase protection against P. dicentrarchi infection (104) Stimulate upregulation of TLR9, IL-1and chemokine CC (105) Decrease sea lice infection in CpG-1668 fed group via induction of inflammatory gene expression (106, 107) |
Rock bream Grouper Pacific red snapper Oliver flounder Cobia Atlantic salmon |
| 2006 | TCGTCGTTTTGTCGTTTTGTCGTT | Induce IgM and antimicrobial peptide gene expression (108) Stimulate IL-1 and IL-6 production and NF-κB activation in head kidney cells (109) Elicit better protection against E. tarda through activation of both TLR9 and TLR21 (86) Stimulate upregulation of IgM, TLR9, IL-1 and chemokine CC (105) Promote IgM secretion and upregulation of cd83, cd40, ifna1 and ifnb (110) Induce MAPK-activated protein kinase 2 activation in phagocytes (111) |
Yellowtail Yellow croaker Zebrafish Cobia Atlantic salmon Atlantic salmon |
| 2007 | TCGTCGTTGTCGTTTTGTCGTT | Increase survival rates following challenge with E. tarda (112) Activate IL-1, IL-6 production and NF-κB activation in head kidney cells (109) Induce protective effect against S. iniae infection (113) Elicit better protection against E. tarda through activation of both TLR9 and TLR21 (86) |
Olive flounder Yellow croaker Nile tilapia Zebrafish |
| 2395 | TCGTCGTTTTCGGCGCGCGCCG | Induce expression of antiviral Mx gene in spleen and liver (105) Upregulation of TLR21 expression (114) |
Cobia Turbot |
| 1013 | CTCACTATCGTTCTTGATT | Increase WBC counts, peroxidase activity and oxidative radicals in head kidney, upregulate immune-related genes and enhance protection against S. iniae infection (115) | Asia sea bass |
| 1670A | TCGAACGTTTTAACGTTTTAACGTT | Induce protective antiviral responses against grass carp reovirus (116) | Grass carp |
| 1826 | TCCATGACGTTCCTGACGTT | Activate IL-1, IL-6 production and NF-κB activation in head kidney cells (109) | Yellow croaker |
| C7 | GGCGCGCGTCGCGCGCTA | Inhibite viral replication, promote proliferation of leukocytes, and enhance activation of head kidney phagocytes (117) | Olive flounder |
| 205 | GATCGCGTGCGTGCGTCTAT | Induce macrophage activation, leukocyte proliferation and protect against lethal E. tarda challenge (118) | Turbot |
| D | ACCGATAACGTTGCCAACGTTGGT | Upregulate leucocyte gene expressions including TNF-α, IL-1, TLR9, IRF-1, Mx, MHCIIa, IgMH and CSF-1R (119) | Gilthead seabream |