Protease activated‐receptor 2 is necessary for neutrophil chemorepulsion induced by trypsin, tryptase, or dipeptidyl peptidase IV

Abstract

Compared to neutrophil chemoattractants, relatively little is known about the mechanism neutrophils use to respond to chemorepellents. We previously found that the soluble extracellular protein dipeptidyl peptidase IV (DPPIV) is a neutrophil chemorepellent. In this report, we show that an inhibitor of the protease activated receptor 2 (PAR2) blocks DPPIV‐induced human neutrophil chemorepulsion, and that PAR2 agonists such as trypsin, tryptase, 2f‐LIGRL, SLIGKV, and AC55541 induce human neutrophil chemorepulsion. Several PAR2 agonists in turn block the ability of the chemoattractant fMLP to attract neutrophils. Compared to neutrophils from male and female C57BL/6 mice, neutrophils from male and female mice lacking PAR2 are insensitive to the chemorepulsive effects of DPPIV or PAR2 agonists. Acute respiratory distress syndrome (ARDS) involves an insult‐mediated influx of neutrophils into the lungs. In a mouse model of ARDS, aspiration of PAR2 agonists starting 24 h after an insult reduce neutrophil numbers in the bronchoalveolar lavage (BAL) fluid, as well as the post‐BAL lung tissue. Together, these results indicate that the PAR2 receptor mediates DPPIV‐induced chemorepulsion, and that PAR2 agonists might be useful to induce neutrophil chemorepulsion.

Abbreviations

ARDS

acute respiratory distress syndrome

BAL

bronchoalveolar lavage

DPPIV

dipeptidyl peptidase IV

FMI

forward migration index

fMLP

N‐formylmethionine‐leucyl‐phenylalanine

PAR

protease activated receptor

PAR1

protease activated receptor 1

PAR2

protease activated receptor 2

SEM

Standard error of the mean

TLCK

tosyl‐l‐lysyl‐chloromethane hydrochloride

TNF‐α

Tumor necrosis factor‐α

1. INTRODUCTION

A variety of cell types exhibit chemotaxis toward chemoattractants, such as the movement of neutrophils toward the peptide fMLP.1 Studies in both Dictyostelium discoideum and neutrophils have elucidated many aspects of chemotaxis mechanisms.2 Comparatively, much less is known about the mechanisms used by cells to move away from chemorepellents.3, 4 Based on initial studies on a Dictyostelium chemorepellent,5, 6, 7, 8, 9 we found that the human extracellular protein dipeptidyl peptidase IV (DPPIV) is a chemorepellent for human and mouse neutrophils.6, 10, 11 Since chemoattractants activate cell surface receptors,4, 12, 13 an intriguing possibility is that a neutrophil chemorepellent such as DPPIV may also activate a neutrophil cell‐surface receptor.

DPPIV activates and induces proliferation of human vascular smooth muscle cells, and this effect can be blocked using an inhibitor of the protease activated cell‐surface receptor (PAR2), as well as a PAR2 siRNA.14, 15 Protease‐activated receptors (PARs) are a four‐member family of G protein coupled receptors.16 PAR2 is activated by proteolytic cleavage of an extracellular domain,17 allowing a portion of the extracellular domain to bind to the receptor and activate it.16 Small molecules such as AC55541,18 and peptides that mimic the released extracellular domain, can be used as PAR2 agonists.17, 19 PAR2 is expressed on neutrophils,20 and in PAR2 knockout mice, depending on the tissue and insult used, lack of PAR2 can lead to more or less inflammation.21

Other proteases also activate PAR2. Mast cells degranulate in response to external stimuli22 to release factors such as the protease tryptase.22, 23, 24 In addition to proteolysis of cell debris, tryptase also signals both monocytes and neutrophils through PAR2.17, 22, 25, 26, 27, 28 Tryptase stimulates neutrophils to upregulate cell adhesion molecules, secrete proteins and cytokines such as lactoferrin and IL‐8, and modulate neutrophil migration.21, 29 Trypsin similarly activates PAR2 to induce inflammation.21 In addition to PAR2, PARs such as PAR1 are present on neutrophils.30 PAR1 is relatively insensitive to tryptase and trypsin, but is sensitive to the protease thrombin.17, 25

There are several diseases that involve an excess number of neutrophils in a tissue, and where a neutrophil chemorepellent could be useful to decrease this localized accumulation of neutrophils. For instance, acute respiratory distress syndrome (ARDS) involves damage to the lungs recruiting neutrophils, neutrophils entering the lungs, activating and causing more lung damage, resulting in further recruitment of neutrophils in a vicious cycle that leads to the death of ∼40% of the ∼200,000 cases of ARDS in the United States.31, 32, 33, 34 ARDS can be approximately modeled in mice by oropharyngeal aspiration into the lungs of damage‐inducing agents such as bleomycin or bacterial LPS. We previously observed that aspiration of the neutrophil chemorepellent DPPIV acts as a therapeutic in a mouse model of ARDS.10 Since DPPIV is a peptidase that cleaves many proteins,35 finding a more inert neutrophil chemorepellent would be more useful as a potential therapeutic. In this report, we show that PAR2 but not PAR1 agonists induce neutrophil chemorepulsion, that DPPIV and PAR2 agonists require PAR2 to induce this chemorepulsion, and that aspiration of low doses of PAR2 agonists are therapeutic in a mouse model of ARDS.

2. MATERIALS AND METHODS

2.1. Cell isolation and culture

Human blood was collected from volunteers who gave written consent and with specific approval from the Texas A&M University human subjects Institutional Review Board. All blood samples were deidentified prior to analysis. Peripheral blood neutrophils were isolated as previously described.10 Neutrophils were isolated from the bone marrow of 6‐ to 10‐week‐old C57BL/6 and Par2^−/− (F2rl1; stock # 004993) mice (The Jackson Laboratory, Bar Harbor, ME, USA) as previously described.36 All mouse experiments were performed in accordance with guidelines published by the National Institutes of Health, and the protocol was approved by the Texas A&M University Animal Use and Care Committee. Mouse genomic DNA was isolated from tail snips as described previously.37 C57BL/6 and PAR2^−/− genotypes were validated with genomic DNA by PCR, using forward 5′ GAAGAAGGCAAACATCGCCG and reverse 5′ GAAGAGCGGAGCGTCTTGAT primers, using 95° C 30 s, 55° C 30 s, and 72° C 30 s, for 20 cycles. PCR fragments were analyzed by agarose gel electrophoresis for a 261 bp Par2 fragment (Supplementary Figure 1A). The cells isolated from the mouse bone marrow were >99% neutrophils, consisting of myelocytes (neutrophil precursors), immature band neutrophils, and mature neutrophils (Supplementary Figure 1B).

2.2. Proteases, PAR agonists, and PAR inhibitors

The PAR‐1 inhibitor vorapaxar (Axon Medchem, Reston, VA, USA), PAR‐1 agonist SFLLRN‐NH2 (American Peptide Company, Sunnyvale, CA, USA), PAR2 agonists 2f‐LIGRL‐NH2 (EMD Millipore, Billerica, MD, USA), SLIGKV‐NH2 (Tocris, Minneapolis, MN, USA), AC55541 (Tocris), TPCK‐treated bovine trypsin (10,000 Nα‐benzoyl‐l‐arginine ethyl ester units/mg, Sigma, St Louis, MO, USA), and human thrombin (1000 NIH units/mg; Sigma) were resuspended following the manufacturer's instructions. Tryptase purified from human mast cells (70 units/mg, Fitzgerald, Acton, MA, USA) mixed with 15 kDa heparin from porcine stomach (Sigma) in a 1:10 molar ratio of tryptase to heparin immediately after thawing,38 and PAR2 inhibitor ENMD‐1068 (50 μg/ml; Enzo Life Sciences, Farmingdale, NY, USA) were used as previously described.39 Tosyl‐l‐lysyl‐chloromethane hydrochloride (TLCK; Sigma), an irreversible inhibitor of trypsin and trypsin‐like serine proteases, was used at 10 nM, and the PAR‐1 inhibitor vorapaxar was used at 25 μg/ ml, both in RPMI/2% BSA.

2.3. Insall chamber assays

Insall chamber (a kind gift of Robert Insall, Beatson Institute for Cancer Research, Glasgow, UK) assays were used to determine the effect of compounds on PBMC and neutrophils in a chemotactic gradient, as previously described5, 10 (Supplementary Figure 2). PAR‐1 agonist SFLLRN‐NH2 and PAR2 agonists 2f‐LIGRL‐NH2, and SLIGKV‐NH2 were added to one side of the Insall chamber at 50 ng/ml, AC55541 was added at 65 ng/ml, and trypsin, tryptase, and thrombin were added at 10 ng/ml. These concentrations were based on the concentrations of PAR2 agonists and proteases that we previously observed to potentiate human fibrocyte differentiation.39 fMLP (Sigma) was used at 1 nM. Recombinant human DPPIV (Enzo Life Sciences, Farmingdale, NY, USA) was added at 2 nM, as previously described.10 At least 10 neutrophils per experiment were tracked for 38 min. For each donor, neutrophils were tracked in a no‐gradient control. Neutrophils were never used past 5 h from the end of the isolation step. We used two Insall chamber/ microscope/ camera setups in parallel, allowing six to eight experimental conditions to be measured per set of donor neutrophils. The results are expressed as the mean ± sem of the movement of neutrophils from three or more different donors. We never used the same donor twice for a given experiment.

2.4. Neutrophil adhesion and survival

A total of 50 ng/ml 2f‐LIGRL‐NH2, 50 ng/ml SLIGKV‐NH2, 130 ng/ml AC55541, 10 ng/ml trypsin, or 10 ng/ml tryptase were used to assess neutrophil survival, as previously described;10, 40 10 ng/ml TNF‐α (BioLegend, San Diego, CA, USA) was used as a positive control. The same concentrations of compounds were used to test neutrophil adhesion to fibronectin as previously described.40, 41 After washing, neutrophil adhesion was assessed by imaging the number of cells adhered to the plate with an InCell 2000 robotic microscope (GE Healthcare, Barrington, IL, USA), after which the number of cells in the images was counted with CellProfiler software.42

2.5. Mouse lung injury

Six‐week‐old C57BL/6 and Par2^−/− mice were treated with an oropharyngeal aspiration of 50 μl saline or 10 ng per gram of mouse body weight (approximately 200 ng per mouse) LPS (Sigma) in 50 μl saline, as previously described.10, 41 Aspiration of liquid into the lungs was confirmed by a crackling noise during respiration; 24 and 48 h after LPS inhalation, mice were treated with 50 μl of either saline or 125 pg/g of the PAR2 agonists 2f‐LIGRL‐NH2, SLIGKV‐NH2, or AC55541 diluted in saline by oropharyngeal aspiration. At 72 h after the LPS inhalation, mice were euthanized, and the bronchoalveolar lavage (BAL) was collected as previously described.10, 41 Each set of experiments was conducted on 1–2 mice per group, and the experiments were repeated three times, for a total of 3–5 mice per group.

2.6. Immunohistochemistry of BAL and lung sections

Immunohistochemistry of BAL and lung sections was performed as previously described.10, 41, 43 Cells and lung sections were stained with antibodies at 5 μg/ml for CD11b (BioLegend), CD11c (BioLegend), Ly6g (BD Biosciences, San Jose, CA), and CD45 (BioLegend), as previously described.10, 41, 43

2.7. Statistical analysis

Data were analyzed by ANOVA (with Dunnett's posttest) or t test when appropriate using Prism software (GraphPad, San Diego, CA, USA). Statistical significance was defined as P < 0.05. Power analysis was done with StatMate (GraphPad).

3. RESULTS

3.1. DPPIV and PAR2 agonists act as neutrophil chemorepellents

We previously observed that DPPIV is a chemorepellent for human and mouse neutrophils.10 Since PAR receptors are present on neutrophils,28 and since PAR receptors may mediate the effects of DPPIV and other proteases,10, 14 we examined whether gradients of trypsin, tryptase, thrombin, the human PAR1 agonist SFLLRN‐NH2, the human PAR2 agonists 2f‐LIGRL‐amide and AC55541, or the mouse PAR2 agonist SLIGKV‐NH2 could affect the movement of human neutrophils. Forward migration index (FMI) measures the distance a cell moves toward or away from the source of a compound, divided by the path length of the movement, with a positive FMI indicating chemorepulsion (Supplementary Figure 3). Gradients of the PAR1 agonist SFLLRN‐NH2 or thrombin, which activates PAR1,17, 25 did not significantly alter neutrophil FMI compared to a no gradient control (Figure 1A). Gradients of the PAR2 agonists 2f‐LIGRL‐amide, SLIGKV‐NH2, or AC55541 induced chemorepulsion at concentrations that we had previously shown to potentiate fibrocyte differentiation39, 44 (Figure 1B). The AC55541 was dissolved in DMSO before being diluted in culture medium, and an identical concentration of DMSO in culture medium did not cause chemorepulsion (Figure 1B). Together, these results indicate that a gradient of PAR2 but not PAR1 agonists causes neutrophils to move away from the source of the agonist.

Figure 3.

Loss of PAR2 reduces the ability of DPPIV and PAR2 agonists to cause chemorepulsion of mouse neutrophils. Neutrophils from C57BL/6 (WT) and Par2^−/− (KO) mice were assayed for chemorepulsion as in Figure 1, and for directness and speed as in Supplementary Figures 4 and 5. Values are mean ± sem. For (A–C), n = 6; for (D–I), n = 3. *P < 0.05 compared to the no‐gradient control for the indicated genotype or the indicated sex, or for the indicated comparison (t test)

Figure 1.

PAR2 activating proteases and agonists induce neutrophil chemorepulsion. Human neutrophils were placed in gradients of the indicated compounds using Insall chambers and videomicroscopy was used to record cell movement. A positive forward migration index indicates chemorepulsion. (A) The effects of SFLLRN, a PAR1 agonist, and thrombin, a PAR1 activating protease. (B) The effects of PAR2 agonists. (C) The effects of DPPIV or the PAR2 activating proteases trypsin and tryptase in the presence or absence of the protease inhibitor TLCK or the PAR2 inhibitor ENMD‐1068. (D) The effects of mixtures of the chemoattractant fMLP and PAR2 activating proteases and agonists. All values are mean ± sem for neutrophils from at least three different donors. *P < 0.05, **P < 0.01, ***P < 0.001 compared to the no‐gradient control, or for the indicated comparison (t test)

As previously observed, DPPIV caused chemorepulsion of neutrophils10 (Figure 1C), and this chemorepulsion was inhibited by preincubating neutrophils with ENMD‐1068, which blocks activation of the PAR2 receptor22 (Figure 1C). Trypsin and tryptase (which both activate PAR2 through their protease activity26, 45 also induced neutrophil chemorepulsion, and this effect was reduced by treating the proteases with the protease inhibitor TLCK, or by preincubating neutrophils with the PAR2 inhibitor ENMD‐1068 (Figure 1C). Trypsin‐induced chemorepulsion was not significantly affected by the PAR1 inhibitor vorapaxar (trypsin FMI 0.17 ± 0.06; trypsin + vorapaxar 0.13 ± 0.05; mean ± sem; t test). In gradients between 10 ng/ml and either 20 ng/ml or 30 ng/ml trypsin, neutrophils moved away from the higher concentration of protease, indicating that neutrophils are capable of detecting protease gradients of different intensities (Figure 1C). Together, these results indicate that inhibiting PAR2 inhibits the ability of DPPIV, trypsin, and tryptase to induce neutrophil chemorepulsion, and that PAR1 does not play a significant role in chemorepulsion from the PAR2 agonists.

To determine if PAR2 activation can induce neutrophil chemorepulsion in the presence of a known neutrophil chemoattractant, we examined the effects of gradients of mixtures of fMLP and either trypsin, tryptase, or the PAR2 agonists 2f‐LIGRL‐amide and AC55541. As previously observed,1 fMLP attracted neutrophils (Figure 1D). Trypsin, tryptase, and 2f‐LIGRL‐amide competed against fMLP‐induced chemoattraction of neutrophils, while AC55541 did not significantly affect fMLP‐induced chemoattraction of neutrophils (Figure 1D). Together, these results indicate that some but not all PAR2 agonists can successfully compete against a neutrophil chemoattractant.

“Directness” is the Euclidean distance between a cell's starting and ending points, irrespective of the direction of the endpoint from the starting point, divided by the path length traveled by that cell. Cells that move directly between points have a greater directness, while cells that meander between points have a lower directness. To determine if the proteases and PAR agonists also influenced the directness of neutrophil movement, we measured the directness of each cell track from the videos assayed in Figure 1 (Supplementary Figure 4). All PAR2 activating proteases and agonists increased neutrophil directness in the presence of fMLP, although fMLP alone did not increase directness. The mixture of AC55541 and fMLP increased neutrophil directness compared to control neutrophil directness by 62 ± 8% (mean ± sem, n = 3). ENMD‐1068 also increased the directness of cells. Only thrombin and tryptase + TLCK decreased directness (Supplementary Figure 4). The directness in a trypsin gradient was not significantly affected by the PAR1 inhibitor vorapaxar (trypsin 0.42 ± 0.04; trypsin + vorapaxar 0.41 ± 0.04; mean ± sem, t test).

Speed is path length traveled by a cell divided by the time that the cell took to take the path. No conditions tested significantly decreased speed, whereas several of the treatments increased the speed of neutrophils (Supplementary Figure 5). For instance, AC55541 increased neutrophil speed compared to the control neutrophils by 54 ± 8%. The speed of cells in a trypsin gradient was increased by the PAR1 inhibitor vorapaxar (trypsin 12.5 ± 0.8 μm/min; trypsin + vorapaxar 17.3 ± 1.5; mean ± sem, P < 0.05 by t test). Together, these results indicate that the PAR2 agonists were not inducing neutrophil chemorepulsion simply by increasing directness, that the protease inhibitor TLCK and the PAR2 inhibitor ENMD‐1068 were not inhibiting chemorepulsion simply by inhibiting cell speed, and that PAR1 may affect cell speed.

3.2. PAR2 agonists do not increase neutrophil death

As migration is a combination of adhesion and motility,46, 47 we tested if trypsin, tryptase, or the PAR2 agonists 2f‐LIGRL‐amide, SLIGKV‐NH2, or AC55541 affect the adhesion of neutrophils to fibronectin. As previously observed, compared to no treatment, TNF‐α increased neutrophil adhesion10, 40, 41 (Figure 2A). No protease or agonist significantly increased neutrophil adhesion, whereas SLIGKV‐NH2 slightly reduced neutrophil adhesion (92 ± 5% of the control) (Figure 2A). We also determined if PAR2 agonists affect neutrophil survival. Neutrophils were incubated with PAR2 agonists for 22 h, followed by staining with propidium iodide. As previously observed, compared to no treatment, TNF‐α significantly increased the total number of neutrophils after 22 h, as determined by gating for live cells based on forward and side‐scatter characteristics10 (Figure 2B). Trypsin and tryptase also increased numbers of surviving neutrophils (Figure 2B). TNF‐α and all of the PAR2 agonists reduced the numbers of dead (propidium iodide positive) neutrophils (Figure 2C and Supplementary Figure 6). Together, these results suggest that at the concentrations used in the Figure 1 experiments, trypsin, tryptase, 2f‐LIGRL‐amide, SLIGKV‐NH2, and AC55541 induce neutrophil chemorepulsion without having a major effect on neutrophil adhesion to fibronectin, and that they do not increase neutrophil death.

Figure 2.

The effects of PAR2 agonists on neutrophil adhesion and survival. Neutrophils were incubated with the indicated PAR2 agonists or TNF‐α as a positive control for neutrophil survival and adhesion. (A) Neutrophils were allowed to adhere to a fibronectin‐coated plate. After 1 h, non‐adhered cells were washed off, and adhered cells were counted. Numbers were normalized to the no‐treatment control, and expressed as the percentage of the control. (B) Neutrophils were incubated for 22 hr, resuspended, and counted using a flow cytometer, gating for neutrophils by forward and side scatter. (C) Neutrophils as in B were stained with propidium iodide. All values are mean ± sem, n = 4, *P < 0.05, **P < 0.01, ***P < 0.001 compared to control (one‐way ANOVA with Dunnett's test)

3.3. PAR2 is required for chemorepulsion of mouse neutrophils by PAR2 agonists

To test the hypothesis that PAR2 agonists require PAR2 to induce neutrophil chemorepulsion, we examined the movement of neutrophils from Par2^−/− mice. The original Par2^−/− mice were backcrossed to a C57BL/6 background at Jackson Laboratories, so we used C57BL/6 as the Par2^+/+ control. In the absence of a gradient, C57BL/6 and Par2^−/− neutrophils had no significant differences in FMI (Figure 3A and Supplementary Figure 7) or directness (Figure 3B), while Par2^−/− neutrophils moved significantly faster (19 ± 7%, Figure 3C), indicating that disruption of Par2 does not inhibit general neutrophil motility. The neutrophil chemoattractant fMLP caused chemoattraction, increased the directness, and increased the speed of neutrophils from C57BL/6 and Par2^−/− mice (Figure 3A–C), indicating that disruption of Par2 does not inhibit chemotaxis. Gradients of fMLP did not significantly change Par2^−/− neutrophil FMI, directness, or speed in comparison to C57BL/6 neutrophils, showing that disruption of Par2 does not affect neutrophil movement in response to another chemotactic molecule (fMLP). DPPIV, AC55541, SLIGKV, trypsin, and tryptase all caused chemorepulsion of wild‐type C57BL/6 neutrophils, but did not cause chemorepulsion of Par2^−/− neutrophils, and trypsin appeared to attract Par2^−/− neutrophils (Figure 3A). Several of the PAR2 agonists also increased neutrophil directness and/or speed, and none of the agonists appeared to decrease directness or speed compared to no agonist (Figure 3B and C). Trypsin increased the directness of C57BL/6 neutrophils compared to Par2^−/− neutrophils by 26 ± 7%, and AC55541 increased the speed of C57BL/6 neutrophils compared to Par2^−/− neutrophils by 28 ± 5%. Together, these results suggest that PAR2 is required for neutrophil chemorepulsion from DPPIV, AC55541, SLIGKV, trypsin, and tryptase.

The chemorepulsion from PAR2 agonists was observed for both male and female C57BL/6 mice, although DPPIV and AC55541 had a stronger effect on male compared to female mice. In the absence of a gradient, neutrophils from C57BL/6 female mice moved 31 ± 5% more directly than those isolated from C57BL/6 male mice, while in a fMLP gradient, the female neutrophils moved 21 ± 8% less directly than male neutrophils (Figure 3E). Female neutrophils moved more slowly than male neutrophils in gradients of AC55541 (23 ± 6% reduction), SLIGKV (25 ± 10% reduction), and fMLP (42 ± 6% reduction) (Figure 3F). For Par2^−/− mice, compared to male neutrophils, female neutrophils had a stronger attraction to fMLP, less directness in an AC55541 gradient (33 ± 9% reduction), faster speed in DPPIV (57 ± 9% increase) and fMLP (26 ± 8% increase), and slower speed in AC55541 (23 ± 9% reduction) (Figure 3G–H). Together, these results indicate that for both male and female mice, PAR2 is necessary for the chemorepulsion caused by PAR2 agonists.

3.4. PAR2 agonists reduce the number of neutrophils in the lungs in a mouse model of ARDS

Since PAR2 agonists act as neutrophil chemorepellents, we tested the hypothesis that PAR2 agonists could be effective treatments for ARDS in a mouse model. Mice were treated with oropharyngeal aspiration of LPS on day 0, and then treated by aspiration of either saline or the PAR2 agonists 2f‐LIGRL‐amide, SLIGKV‐NH2, or AC55541 at 24 and 48 h. At 72 h, mice were euthanized, and weakly adhered cells in the airways were collected by BAL. Compared to saline treated mice, there was no significant difference in the weights of mice treated with PAR2 agonists by either 1‐way ANOVA or t test (Figure 4A). As previously observed,48 LPS treatment increased numbers of total cells, Ly6g‐positive neutrophils, and CD11b‐positive neutrophils and macrophages in the BAL (Figure 4B–D). After LPS, treatment with all three of the PAR2 agonists did not significantly affect total cell counts or CD11b counts (Figure 4B and D), but significantly reduced numbers of Ly6g positive cells in the BAL (SLIGKV‐NH2 reduction = 76.2 ± 6.4%, 2f‐LIGRL‐NH2 reduction = 92.2 ± 2.3%, AC55541 reduction = 90.2 ± 5.4%, Figure 4C). None of the treatments significantly affected the numbers of CD11c dendritic cells and resident macrophages in the BAL (Figure 4E). For control mice, the BAL cell number was 8.4 ± 2.0 × 10⁴ (mean ± SD, n = 5), and for the LPS‐treated mice the BAL cell number was 24.8 ± 13.4 × 10⁴ (mean ± SD, n = 4). The difference in the means of these two groups is 16.4 × 10⁴. With the constraints of an unpaired t test, this experiment had an 80% power (a standard readout for many studies49, 50, 51) to detect a difference between means.

Figure 4.

PAR2 agonists cause neutrophil chemorepulsion in a mouse model of ARDS. C57BL/6 mice were treated with aspirated saline or LPS at day 0, and then treated at day 1 and day 2 with aspiration of the indicated material, and then sacrificed at day 3. (A) Mice were weighed at the indicated times. Compared to the mice treated with LPS on day 0 and then saline on days 1 and 2 (LPS‐Saline), there were no statistical differences with any group on any day (t test). (B–E) After sacrificing mice, bronchoalveolar lavage (BAL) fluid was collected and the cells were stained to count the total number of cells (B), the number of Ly6g‐positive neutrophils (C), the number of CD11b‐positive neutrophils and macrophages (D), and the number of CD11c‐positive lung resident dendritic cells and macrophages (E). Values are mean ± sem, n = 4. *P < 0.05, **P < 0.01 compared to LPS on day 0 and saline on days 1 and 2 (one‐way ANOVA, Dunnett's test)

Following BAL, sections of the lungs were stained. As previously observed, LPS caused an increase in CD45‐positive leukocytes, and Ly6g‐, CD11b‐, and CD11c‐positive cells in the post‐BAL lungs48 (Figure 5A–D). After LPS, AC55541 decreased CD45‐ and CD11b‐positive cells by 51 ± 18% and 57 ± 7%, respectively (Figure 5A C). After LPS, all three of the small‐molecule PAR2 ligands (SLIGKV, 2f‐LIGRL, and AC55541) decreased the numbers of Ly6g positive cells by 61 ± 15%, 46 ± 9%, and 69 ± 5%, respectively. (Figure 5B). After LPS, all three small‐molecule PAR2 ligands (SLIGKV, 2f‐LIGRL, and AC55541) also decreased the numbers of CD11c‐positive cells by 39 ± 8%, 52 ± 1%, and 64 ± 9%, respectively (Figure 5D). Together, these data suggest that low‐dose PAR2 agonists can reduce the numbers of Ly6g‐positive neutrophils in the BAL fluid and the post‐BAL lungs, and reduce the numbers of CD11c‐positive cells in the post BAL lungs, in a mouse model of ARDS.

Figure 5.

Mice treated with PAR2‐agonists have fewer leukocytes in their lungs. After collecting the BAL, lungs were sectioned and stained for (A) CD45, (B) Ly6g, (C) CD11b, and (D) CD11c. Values are mean ± sem, n = 4. *P < 0.05, **P < 0.01 compared to LPS on day 0 and saline on days 1 and 2 (one‐way ANOVA, Dunnett's test)

4. DISCUSSION

We previously found that DPPIV is a neutrophil chemorepellent.10, 11 In this report, we show that the PAR2 agonists trypsin and tryptase, and three small‐molecule PAR2 agonists, also act as chemorepellents for human neutrophils. The chemorepulsion does not appear to be due to a general activation of PARs, since PAR1 agonists do not appear to act as neutrophil chemorepellents and a PAR1 inhibitor was unable to inhibit chemorepulsion from trypsin. Three observations support the idea that PAR2 activation mediates the chemorepulsion. First, PAR2 activation by a protease requires the protease activity,52 and the trypsin‐specific protease inhibitor TLCK blocked the ability of trypsin and tryptase to induce chemorepulsion. Second, the PAR2 inhibitor ENMD‐1068 blocked the ability of DPPIV, trypsin, and tryptase to induce chemorepulsion. Third, neutrophils from both male and female mice lacking PAR2 were insensitive to DPPIV and PAR2 agonist‐induced chemorepulsion.

The chemorepellent AprA increased the directness of Dictyostelium cells,5, 6, 7, 9 while DPPIV10, 11 and the PAR2 agonists induced chemorepulsion without increasing directness. This suggests a difference in the chemorepulsion mechanisms used by AprA compared to the DPPIV and PAR2 agonists. AprA did not affect cell speed,5 and DPPIV and trypsin also did not affect speed, although tryptase and two of the three small‐molecule PAR2 agonists increased cell speed. A common feature of the chemorepulsion induced by DPPIV and the PAR2 agonists thus appears to be an effect on the direction of cell movement without a significant increase in the directness of cell movement. This type of chemotaxis is different from chemoattraction, where the chemoattractant tends to increase directness and speed.53, 54

Other workers found that coaspiration of 0.5 mg of the PAR2 agonist SLIGRL along with LPS reduces LPS‐increased neutrophil numbers in the BAL fluid of mice.55 Depending on the model, disruption of Par2 can result in more or less inflammation,56, 57, 58, 59, 60, 61, 62, 63, 64, 65 suggesting that PAR2‐mediated chemorepulsion might drive neutrophils into a region of inflammation in some circumstances, and drive neutrophils out in other circumstances. In this report, we found that aspiration of ∼2.5 ng of similar PAR2 agonists starting 24 h after the LPS insult also reduces the numbers of neutrophils in the both the BAL fluid as well as the post‐BAL lung tissue in this model of ARDS. Our work thus extends the previous studies, suggesting that PAR2 agonists could be used therapeutically in addition to prophylactically, that the PAR2 agonists decrease neutrophils in the post‐BAL tissue as well as the BAL, and that considerably lower doses of PAR2 agonists are effective. We also observed that aspiration of PAR2 agonists decrease LPS‐increased CD11c‐positive cell numbers in the post‐BAL lung tissue, suggesting that aspirated PAR2 agonists decrease LPS‐induced lung inflammation. The observation that PAR2 agonists do not appear to decrease neutrophil viability suggests that the aspirated PAR2 agonist effects on decreasing lung neutrophil numbers in the mouse ARDS model were not due to PAR2‐induced neutrophil cell death. In ARDS, chemoattractants appear to recruit neutrophils to the lungs,34, 66 and in gradient chambers, some PAR2 agonists blocked the ability of the chemoattractant fMLP to recruit neutrophils. This then suggests that in the mouse ARDS model, the aspirated PAR2 agonists may have decreased LPS‐increased lung neutrophil numbers either by inhibiting neutrophil recruitment to the lungs, or by actively inducing neutrophil chemorepulsion out of the lungs.

Of the 5 PAR2 agonists examined, only SLIGKV decreased neutrophil adhesion. We previously observed that the plasma protein serum amyloid P (SAP) decreases neutrophil adhesion to a variety of surfaces, and that intraperitoneal SAP injections in a mouse model of ARDS starting at 24 h after the insult decreases neutrophil numbers in the lungs.40, 41 These observations suggest that aspiration of PAR2 agonists and injections of SAP might decrease lung neutrophil numbers in a mouse model of ARDS using different mechanisms. This in turn suggests that PAR2 agonists activating the PAR2‐mediated chemorepulsion mechanism, and SAP decreasing the ability of neutrophils to strongly adhere to lung tissue, might act synergistically as potential therapeutics for ARDS.

DISCLOSURES

The authors declare no conflict of interest.

Supporting information

Supplemental Figure 1. Characterization of Par2 ^−/− genotype and bone marrow neutrophils. (A) Analysis of PCR products from genomic DNA by agarose gel electrophoresis. C57BL/6 (WT) mice have a 261 base pair (bp) fragment, but Par2 ^−/− (KO) mice have no product. Control PCR reaction (‐) contained no DNA. The positions of molecular mass standards in bp are indicated at left. (B) Cells attached to fibronectin‐coated coverslips were air dried, fixed in methanol, and stained with methylene blue and eosin. PMN indicates polymorphonuclear neutrophils. Values are mean ± SEM, n = 8 WT and 7 Par2 ^−/−.

Supplemental Figure 2. Schematic of the Insall chamber. Plan view: The chemo‐stimulant (red) and buffer/control (blue) reservoirs are separated by the clear plastic viewing bridges (V) and the coverslip support ring (S). Initially both reservoirs are filled with control medium lacking chemo‐stimulants. The viewing bridges are slightly lower (below the plane of the image) than the rest of the Insall chamber to allow for movement of fluid between the two reservoirs. A coverslip with bound neutrophils is then placed onto the Insall chamber, forming a seal with the coverslip support ring, and a pipette tip is used to drain the outer reservoir. The reservoir is immediately refilled with buffer containing a chemo‐stimulant (Red). The chamber is then inverted, and placed on an inverted microscope with the cells bound to the coverslip in close proximity to the objective lens. Side view shows a cross section along the black line in Plan View; for clarity the vertical axis is enlarged and the cells are greatly enlarged. The coverslip (grey) touches the coverslip supports; the viewing bridges are relatively far above the cells and form a thin gap where the gradient forms above the black arrows. The microscope objective (not shown) below the coverslip can then observe the cells in the space between the coverslip and the viewing bridge

Supplemental Figure 3. Human neutrophils show biased movement away from the PAR2 agonist SLIGKV. Neutrophil migration was measured in the (A) absence or (B) presence of a 0–50 ng/ml SLIGKV gradient. Neutrophils were filmed and tracked for 60 minutes, and the paths were plotted with the start of each path moved to the origin and the end position of the cell marked with a black dot. Orientation is such that the source of SLIGKV is on the left. Graphs are data from one of four independent experiments. Red dots represent the average center of mass for the ending positions of all cells.

Supplemental Figure 4. The directness of movement for the neutrophils analyzed in Figure 1. The data analyzed for Figure 1 was also analyzed for the directness of cell movement in any direction. Values are mean ± SEM. * indicates p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 compared to the no‐gradient control (t tests).

Supplemental Figure 5. Cell speed for the neutrophils analyzed in Figure 1. The data analyzed for Figure 1 was also analyzed for the speed of cell movement. Values are mean ± SEM. * indicates p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 compared to the no‐gradient control (t tests).

Supplemental Figure 6. Analysis of propidium iodide staining in neutrophils. Neutrophils were incubated with buffer (A, B), TNF‐α (C), trypsin (D), tryptase (E), 2f‐LIGRL (F), SLIGKV (G), or AC55541) (H) for 22 hours. The cells were then resuspended and either not stained (A) or stained with propidium iodide (B‐H) and analyzed by flow cytometry. The percentage of cells showing positive propidium iodide staining is indicated by the histogram marker M1. Plots are representative of four individual experiments.

Supplemental Figure 7. Murine C57BL/6 but not Par2 ^−/− neutrophils show biased movement away from the PAR2 agonist SLIGKV. (A and B) C57BL/6 and (C and D) Par2 ^−/− neutrophil migration was measured in the (A and C) absence or (B and D) presence of a 0–50 ng/ml SLIGKV gradient. Neutrophils were filmed and tracked for 60 minutes. Orientation is such that the source of SLIGKV is on the left. Graphs are data from one of four independent experiments with plots done as in Figure S3. Red dots represent the average center of mass for the ending positions of all cells.

White MJ, Chinea LE, Pilling D, Gomer RH. Protease activated‐receptor 2 is necessary for neutrophil chemorepulsion induced by trypsin, tryptase, or dipeptidyl peptidase IV. J Leukoc Biol. 2018;103:119–128. 10.1002/JLB.3A0717-308R