Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Fluorescence in situ hybridization with probes containing short tandem motifs. (a) Probe number 11 with the sequence of (TCGGATCGGT)n applied on chromosomes of A. ursinum (b) Probe number 5 with the sequence of (AATCGTTTTCAATTCAATTCATTTCGA)n on chromosomes of A. sativum. The specific probe signals are in red; DAPI staining in blue. The picture (b) exemplifies a dispersed signal pattern obtained for most of the STMs tested (Figure S6). Scale bar, 10 µm.
