Table 3.

List of short tandem motifs selected for FISH and their read number per species.

Probe	Tandem Repeat Unit	Number of Detected Reads
		A. cepa			A. ursinum			A. sativum
		S1	S2	S3	S4	S5	S6	S7	S8	S9
1	TTAA	4636	4481	4651	1207	1251	1265	135	100	124
2	TATG	4279	4088	4349	589	646	616	1086	984	1055
3	TTTAAAATAG	646	589	671	4	4	2	2	3	2
4	TTTGTGCCTTCGGG	321	294	340	0	0	3	0	1	1
5	AATCGTTTTCAATTCAATTCATTTCGA	31	94	16	56	74	58	10748	10846	10322
6	ATGAATATCAATTCAACAC	11	19	13	19	21	26	4369	4471	4237
7	TTGAA	48	61	34	762	775	776	3737	3831	3598
8	AAATAGAAATATTTG	23	36	7	21	19	20	3793	3838	3803
9	TTAGGG	1	4	4	1	2	1	12	20	18
10	AAATATATTTGGGAT	4	2	2	2541	2575	2514	5	5	3
11	TCGGATCGGT	1	8	2	2297	2254	2177	2	5	4
12	TTTAGGG	8	1843	6	23	14	24	6	14	11

1—the most abundant short tandem motif (STM) in A. cepa and obviously less represented in the other species. 2—the most abundant tetranucleotide tandem in A. sativum, however an even higher amount of it was detected in A. cepa. 3—the most abundant 10-nucleotide tandem in A. cepa. 4—a species specific tandem motif in A. cepa. 5—a tandem 27-nucleotide motif representing the largest genomic proportion if we consider all STM from all three species, but it is rather species-specific for A. sativum. 6—the most abundant 19-nucleotide tandem in A. sativum, 7—the most abundant pentanucleotide motif in A. sativum. 8—the most frequent 15-nucleotide motif in A. sativum. 9—interestingly, some reads containing vertebrate-like telomere sequences are present in all species but slightly more in A. sativum. 10 and 11 represent the most frequent motifs according to their motif lengths. 12—some reads containing Arabidopsis-like telomere sequences are present in all species but slightly more in A.ursinum (outlier value, 1843, in the A. cepa S2 is probably an artefact of NGS processing).