Table 1.
Primers, plasmids, and C. bescii strains generated and/or used in this study
| (A) | |
|---|---|
| Primer name | Sequence |
| pDCW88 gib assy backbone fwd | gtgcactctgacgctc |
| pDCW88 gib assy backbone rev | ggtaccaccagcctaac |
| pDCW88_athe_0654_up_fwd | tccaatgatcgaagttaggctggtggtaccatatcttcaattttgtccacagcag |
| pDCW88_athe_0654_up_rev | ttacataacgcattcatttcacctcaagtccttttctcccccttatcttcttttg |
| pDCW88_athe_0654_down_fwd | gacttgaggtgaaatgaatgc |
| pDCW88_athe_0654_down_rev | gttttcgttccactgagcgtcagagtgcacaacctttctaaattacttgcaacaag |
| upstm 5′ flank fwd athe_0654_P3 | agaatattgaagcgccgaac |
| dnstm 3′ flank rev athe_0654_P3 | gtggaaaaatcaccccagaa |
| internal fwd athe_0654_P3 | gggtttggtcagcaaggata |
| internal rev athe_0654_P3 | acccttaatcccaccttcaa |
| 3′ flank rev seq athe_0654_P3 | tttgcaagatttgcgtaaga |
| (B) | ||
|---|---|---|
| Plasmid | Description | Reference |
| pETE01 | Non‐replicating suicide vector used to generate strains JWCB005Δrex and JWCB032Δrex | This study |
| pTXB1::rex | IPTG‐inducible expression vector used to express recombinant Rex protein in E. coli T7 Express | This study |
| (C) | |||
|---|---|---|---|
| Strains | Description | Genotype | Reference |
| JWCB005 | Genetic background strain used to generate JWCB005Δrex, wildtype ldh locus | ΔpyrFA (ura −/5‐FOAR) | Farkas et al. (2013) |
| JWCB005 Δrex | Markerless rex deletion using strain JWCB005 as genetic parent | ΔpyrFA Δrex (ura −/5‐FOAR) | This study |
| JWCB032 | Genetic background strain used to generate JWCB032Δrex, ldh locus disrupted by ISCbe4, expressing genomically integrated bifunctional alcohol dehydrogenase (AdhE) from C. thermocellum | ΔpyrFA ldh::ISCbe4 ΔcbeI::Ps‐layer Cthe‐adhE (ura −/5‐FOAR) | Hamilton‐Brehm et al. (2010) |
| JWCB032 Δrex | Markerless rex deletion using strain JWCB032 as genetic parent | ΔpyrFA Δrex ldh::ISCbe4 ΔcbeI::Ps‐layer Cthe‐adhE (ura −/5‐FOAR) | This study |