Table 1.
Characteristics of CRISPRs targeting prdm12b, bhlhe22 and nkx6.1
| Target gene | Start Coordinate | Target sequence | Enzyme | Strand | Mutagenesis Ratea | Transmission Rateb |
|---|---|---|---|---|---|---|
| prdm12b | Chr5:66656496 | GCTGGGGGAACACCTGTTCG | Taq1α | + | 1/4 | 71/92 um318 43/79 um319 |
| bhlhe22 | Chr24:25069884 | TTCACACACAAAGATCCGGT | BstYI | – | 6/14 | 24/37 um320 |
| nkx6.1 | Chr21:17886500 | AGTGGAGGATGCTGGTCCAG | AvaII | – | 8/12 | 18/21 um321 |
aThe fraction of screened F0 animals that carried a mutagenic event
bThe fraction of screened F1 animals that were heterozygous for a mutagenic event