Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2019 Feb 27.
Published in final edited form as: Cell Signal. 2018 Aug 7;51:130–138. doi: 10.1016/j.cellsig.2018.07.009

Cellular Phosphatase Activity of C1-Ten/Tensin2 is Controlled by Phosphatidylinositol-3,4,5-triphosphate Binding through the C1-Ten/Tensin2 SH2 Domain

Eui Kim a,c, Do-Hyeon Kim b, Indira Singaram d, Heeyoon Jeong b,c, Ara Koh b, Jiyoun Lee b,c, Wonhwa Cho d,*, Sung Ho Ryu a,b,c,*
PMCID: PMC6392469  NIHMSID: NIHMS993699  PMID: 30092354

Abstract

Regulation of tyrosine phosphorylation on insulin receptor substrate-1 (IRS-1) is essential for insulin signaling. The protein tyrosine phosphatase (PTP) C1-Ten/Tensin2 has been implicated in the regulation of IRS-1, but the molecular basis of this dephosphorylation is not fully understood. Here, we demonstrate that the cellular phosphatase activity of C1-Ten/Tensin2 on IRS-1 is mediated by the binding of the C1-Ten/Tensin2 Src-homology 2 (SH2) domain to phosphatidylinositol-3,4,5-trisphosphate (PtdIns(3,4,5)P3). We show that the role of C1-Ten/Tensin2 is dependent on insulin-induced phosphoinositide 3-kinase activity. The C1-Ten/Tensin2 SH2 domain showed strong preference and high affinity for PtdIns(3,4,5)P3. Using site-directed mutagenesis, we identified three basic residues in the C1-Ten/Tensin2 SH2 domain that were critical for PtdIns(3,4,5)P3 binding but were not involved in phosphotyrosine binding and PTP activity. Using a PtdIns(3,4,5)P3 binding-deficient mutant, we showed that the specific binding of the C1-Ten/Tensin2 SH2 domain to PtdIns(3,4,5)P3 allowed C1-Ten/Tensin2 to function as a PTP in cells. Collectively, our findings suggest that the interaction between the C1-Ten/Tensin2 SH2 domain and PtdIns(3,4,5)P3 produces a negative feedback loop of insulin signaling through IRS-1.

Keywords: C1-Ten/Tensin2; Src-homology 2 domain; Insulin receptor substrate-1; Phosphatidylinositol-3,4,5-triphosphate binding; Protein tyrosine phosphatase

1. Introduction

Insulin signaling involves an integrated network, whose metabolic, transcriptional, and mitogenic roles are controlled by reversible tyrosine phosphorylation. Aberrant regulation of insulin signaling causes pathological conditions such as insulin resistance, which may progress to type 2 diabetes [1]. Insulin receptor substrate-1 (IRS-1), a key component of insulin signaling, becomes rapidly tyrosine-phosphorylated in response to insulin [2]. Phosphorylated IRS-1 generates docking sites for downstream effector molecules, which then mediate different signaling pathways. Thus, the steady state level of IRS-1 tyrosine phosphorylation determined by protein tyrosine kinases and protein tyrosine phosphatases (PTPs) dictates the degree of insulin signaling, which must be tightly controlled. PTPs are important negative regulators of insulin signaling that catalyze the dephosphorylation of tyrosine-phosphorylated proteins [3]. However, in contrast to our extensive knowledge of the catalytic functions of PTPs, the mechanism underlying their regulation has remained unclear.

C1-Ten/Tensin2 (also known as TENC1; referred to as C1-Ten hereafter) belongs to the tensin family, which is a group of focal adhesion molecules that interact with integrin [4], receptor tyrosine kinases [5], and actin [6]. It has been suggested that C1-Ten functions as a biological regulator for the Akt/PKB pathway [7–9] and its interaction with deleted in liver cancer 1 (DLC-1) provides tumor-suppressive function [10, 11]. We identified the metabolic role of C1-Ten as an active PTP of insulin signaling components, which regulate the phosphoinositide 3-kinase (PI3K) binding site, and contributes to pathological conditions such as diabetes [12, 13]. In addition, it has been suggested that C1-Ten may be an interesting therapeutic target in diabetes, because its expression appears upregulated under such conditions and may lead to insulin resistance [14]. C1-Ten is a relevant PTP in insulin signaling that directly interacts with IRS-1, without affecting insulin receptor tyrosine phosphorylation [13]. However, little is known at present regarding the mechanism by which C1-Ten PTP activity is regulated in response to insulin at the molecular level.

In this study, we examined a novel regulatory mechanism for C1-Ten PTP activity mediated by PI3K. We suggest that the C1-Ten Src-homology 2 (SH2) domain is a lipid-binding domain with specificity for phosphatidylinositol-3,4,5-triphosphate (PtdIns(3,4,5)P3). Furthermore, we determined the role of PtdIns(3,4,5)P3 in the regulation of the C1-Ten PTP activity through mutation of residues involved in PtdIns(3,4,5)P3 binding. Collectively, our data provide the first evidence for PtdIns(3,4,5)P3 binding activity of the SH2 domain of C1-Ten and its importance in regulating the phosphorylation of IRS-1 in insulin signaling pathways.

2. Materials and methods

2.1. Antibodies and reagents

Insulin (I5500, Lot 79H0566), LY294002 (440202, Lot 2825363), and anti-Flag antibody (F7425, Lot 001M4789) were purchased from Sigma Aldrich (St. Louis, MO, USA). Anti-Tensin 2 (11990, Lot 1), anti-phospho-Akt (T308) (9275, Lot 20), and anti-phospho-Akt (S473) (9271S, Lot 13) antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA). Antibodies against IRS-1 (06–248, Lot 32682) and phospho-IRS-1 (Y612) (09–432, Lot 2382120) were obtained from Millipore (Billerica, MA, USA). Anti-Akt1/2 (sc-1619, Lot E1013) was purchased from Santa Cruz Biotechnology (Dallas, TX, USA). The following lipids were used for surface plasmon resonance (SPR) analysis: 1-palmitoyl-2-oleoyl-sn-glycero-3phosphocholine (POPC, 850457P), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoserine (POPS, 840034P, both Avanti Polar Lipids, Alabaster, AL, USA), 1,2-dipalmitoyl derivatives of Ptdins(3,4,5)P3 (64920), phosphatidylinositol-4,5-bisphosphate (PI(4,5)P2, 10008115), phosphatidylinositol-3,4-bisphosphate (PI(3,4)P2, 64922), phosphatidylinositol-3,5bisphosphate (PI(3,5)P2, 10008398), phosphatidylinositol-3-monophosphate (PI(3)P, 64921), phosphatidylinositol-4-monophosphate (PI(4)P, 64923), and phosphatidylinositol-5monophosphate (PI(5)P, 64925, all Cayman Chemical, Ann Arbor, MI, USA).

2.2. Plasmids

Full-length plasmids bearing Flag-C1-Ten and EGFP-C1-Ten were generated as described previously [13, 15]. The SH2 domain (amino acids 1120–1253) of C1-Ten was inserted between the XhoI and EcoRI restriction sites of pRSET-B vector (Invitrogen, Carlsbad, CA, USA) with a His6 tag at the N-terminus and an EGFP epitope at the C-terminus for SPR analysis. Full-length C1-Ten was sub-cloned into the EcoRI and XbaI restriction sites of the p3XFlag-CMV10 vector (Sigma Aldrich) [14] for stable expression in HEK293 cells. Point mutations of C1-Ten were generated with a QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA).

2.3. Cell culture and transfection

L6 myoblasts were grown and maintained in low-glucose α-minimal essential medium (α-MEM LM 008–01, Welgene, Gyeongsan, Korea) supplemented with 10% (v/v) fetal bovine serum (FBS, 16000–044, Gibco, Life Technologies, Carlsbad, CA, USA). For the C1-Ten knockdown experiment, AllStars negative-control small interfering RNA (siRNA) (siCon, Qiagen, Valencia, CA, USA), C1-Ten siRNA1 (targeting the C1-Ten sequence TCAGTGGATTACAACATGACA) and siRNA2 (targeting the C1-Ten sequence CCAGTGGACACAGCACACTG) (Bioneer, Daejeon, South Korea) were used, as described previously [13]. L6 myoblasts were transfected with either 100 nM siCon, siRNA1, or siRNA2 using Lipofectamine RNAiMax (13778–075, Invitrogen) according to the manufacturer’s instructions. HEK293 cells were grown and maintained in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, 12–604F, Lonza, Basel, Switzerland) supplemented with 10% (v/v) FBS (14–506F, Lonza). Transfection of HEK293 cells was performed using Lipofectamine (18324–020, Invitrogen) according to the manufacturer’s instructions.

2.4. Cell lysis and western blotting

Harvested cells were lysed in buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM Na3VO4, 20 mM NaF, 10 mM glycerophosphate, 1 mM PMSF, 10% glycerol, 1% triton X-100, and a protease inhibitor cocktail. Samples were centrifuged at 14,000 rpm for 15 min at 4 °C; the resulting supernatants were separated by SDS-PAGE, transferred to a nitrocellulose membrane (GE Healthcare, Little Chalfont, UK), and probed using various antibodies. The blots were then reacted with secondary antibodies, followed by enhanced chemiluminescence (ECL; Thermo Fisher Scientific). Positive immunoreactive bands were quantified by densitometric analysis using ImageJ software (NIH, Bethesda, MD, USA) and compared with those of the control.

2.5. Protein expression and purification

A recombinant construct of the C1-Ten SH2 domain was expressed in Escherichia coli BL21(DE3)pLysS (Novagen, Madison, WI, USA) at 16 °C in the presence of 1 mM isopropyl beta-D-thiogalactopyranoside (Sigma Aldrich). Cell pellets were lysed and sonicated in a buffer containing 50 mM Tris-HCl (pH 7.9), 300 mM NaCl, 10 mM imidazole, and 10% (v/v) glycerol. The lysates were centrifuged at 61,000 × g for 30 min at 4 °C. The supernatant was then mixed with nickel-nitrilotriacetic acid-agarose beads (Qiagen, Hilden, Germany) for 1 h at 4 °C. The resin was washed with washing buffer 1 (50 mM Tris-HCl, 300 mM NaCl, 20 mM imidazole [pH 7.9]), followed by washing buffer 2 (20 mM Tris-HCl, 160 mM NaCl, 20 mM imidazole [pH 7.9]). Bound proteins were eluted with elution buffer (20 mM Tris-HCl, 160 mM NaCl, 300 mM imidazole [pH 7.9]). Eluted fractions were then exchanged to the SPR elution buffer (20 mM Tris-HCl [pH 7.4], 160 mM NaCl) using a PD-10 gel filtration column (GE Healthcare), and equilibrated with the same buffer. Protein purity was checked on a 20% polyacrylamide gel, and protein concentration was determined by a Bradford assay (Bio-Rad Laboratories, Hercules, CA, USA).

2.6. Lipid vesicle preparation and SPR analysis

Large unilamellar vesicles were prepared using a Liposofast microextruder (Avestin, Ottawa, ON, Canada) with a 100-nm polycarbonate filter. Phosphoinositide (PtdInsP) vesicles were prepared by mixing POPC, POPS, and PtdInsP at a molar ratio of 77:20:3 [16]. All SPR measurements were performed on a Biacore T100 system (GE Healthcare) at 25 °C in SPR running buffer containing 20 mM Tris-HCl (pH 7.4) and 160 mM NaCl. PtdInsP vesicles were immobilized onto the active surface, and POPC vesicles were immobilized onto the control surface of L1 chips to yield identical response units and ensure an equal concentration of coated lipids. Equilibrium SPR measurements were done at a flow rate of 5 μl/min to allow sufficient time for the response in the association phase to reach near-equilibrium values (Req) [17]. Different protein concentrations were injected at a flow rate of 10 μl/min to generate a set of Req values to measure the apparent dissociation constant (Kd). Kd values were fitted by nonlinear least squares analysis of the binding isotherm using the following equation: Req = Rmax/(1 + Kd/Po), where Rmax indicates the maximal Req value, and Po indicates protein concentration [18].

2.7. SH2 peptide binding assay by fluorescence anisotropy

A fluorescein-6-aminohexanoyl (F-Ahx)-labeled pY-containing peptide, F-Ahx-NEpYDNV, was used for binding studies, as described previously [19]. The peptide was dissolved in 20 mM Tris buffer (pH 7.4) containing 160 mM NaCl and 5% dimethyl sulfoxide (DMSO). To each well of a 96-flat bottom black polystyrol plate, 100 μl solution was added, containing each peptide (50 nM) and SH2 domain (10 nM to 100 μM). After 30-min incubation, the plate was inserted into a BioTek Synergy Neo microplate reader and the fluorescence anisotropy (r) was measured with excitation and emission wavelengths set at 485 and 535 nm, respectively. Since Po >> Pepo under our conditions, the Kd for the SH2 domain-peptide binding was determined by non-linear least-squares analysis of the binding isotherm using the following equation:

Pepbound/Pepo=Δr/Δrmax=11+Kd/Po

where Pepbound, Pepo, and Po indicate the concentration of bound peptide, total peptide, and total SH2 domain, respectively, and Δr and Δrmax are the anisotropy change for each Po and the maximal Δr, respectively.

2.8. In vitro PTP assay

A PTP assay was performed and its activity was calculated as previously described [13, 14]. Briefly, three 10-cm dishes containing HEK293 cells were transfected with 3 μg Flag C1-Ten plasmids. After 48 h, the cells were lysed in lysis buffer (50 mM Tris-HCI [pH 7.4], 150 mM NaCI, 1 mM EDTA, 10% glycerol, 1 mM PMSF, 20 mM NaF, 0.025% mercaptoethanol, 1% Triton X-100, 0.2% sodium deoxycholate, and a protease inhibitor cocktail). The soluble fractions of the cell lysates were isolated by centrifugation at 14,000 rpm for 15 min at 4 °C. The supernatant was subjected to immunoprecipitation with FLAG M2 affinity Gel for 4 h at 4 °C. After incubation, the immunoprecipitates were washed three times with lysis buffer and once with wash buffer (50 mM Tris-HCI [pH 7.4], 50 mM NaCI, 10% glycerol, 5 mM DTT). Bound proteins were eluted with elution buffer (50 mM Tris-HCI [pH 7.4], 50 mM NaCI, 10% glycerol, 5 mM dithiothreitol, and 100 μg/ml 3× FLAG peptide). After purification, the concentration and activity of purified Flag protein were confirmed ahead of each experiment. Approximately 17 ng/μl C1-Ten wild-type (WT) and C1-Ten K1142Q/K1155Q/K1157Q (3KQ) mutant were obtained. A malachite green assay kit (Millipore) was used to measure PTPase activity. Enzyme reactions were performed in a final volume of 50 μl reaction buffer (50 mM Tris-HCI [pH 7.4], 50 mM NaCI, 5 mM dithiothreitol, 2 mM MgCI2) in 96-well plates at 30 °C for 90 min. The reaction was terminated by adding malachite green detection solution. Absorbance was measured at 620 nm.

2.9. Total internal reflection fluorescence (TIRF) microscopy

Plasma membrane localization of WT and 3KQ mutant forms of C1-Ten were imaged using an objective-type TIRF microscope built on an inverted microscope (IX-81, Olympus, Tokyo, Japan) equipped with an XY-axis automated stage (MS-2000, Applied Scientific Instrumentation, Eugene, OR, USA). A 488-nm laser (35-LAL-415–220R, Melles Griot, NY, USA) was aligned and collimated to focus on the back focal plane of an oil-immersion 60× objective lens (APON 60×OTIRF/1.49, Olympus). A dichroic mirror (ZTUV-405/488/561RPC, Chroma, Taoyuan City, Taiwan) and an emission filter (ZET405/488/561M, Chroma) were used. Images were collected with an electron multiplying charge-coupled device (EM-CCD) camera (iXon3 897, Andor Technology, Belfast, UK). For higher magnification, we used a 1.6× amplifier and inserted a 1.43× tube lens. The images were obtained before and after insulin treatment (2 min, 5 min, 7 min, and 9 min) at a frame rate of 20 Hz. At the indicated time point, the fluorescence intensity of each cell was subtracted from the background fluorescence measured outside the cell. Fluorescence intensity was determined for each condition by normalizing fluorescence intensity of the image in the NT condition.

2.10. Stable cell line preparation

The full-length coding regions of WT and 3KQ C1-Ten were subcloned into the p3XFlag-CMV10 vector (Sigma Aldrich) and transfected into HEK293 cells to establish stable cell lines. Transfected HEK293 cells were selected following addition of 400 μg/ml geneticin sulfate G418 (Gibco) to the complete medium. G418-resistant cells were then analyzed for the presence of WT and 3KQ C1-Ten by western blotting using an anti-Flag antibody. We confirmed the parallel expression of WT and 3KQ C1-Ten.

2.11. Statistical analysis

All results are presented as the mean ± standard error of the mean (SEM). Experimental data were compared using analysis of variance (ANOVA) with Tukey’s post-hoc test or an unpaired two-tailed Student’s t-test. A value of P < 0.05 was considered significant.

3. Results

3.1. C1-Ten attenuates IRS-1 phosphorylation in a PI3K-dependent manner

We previously reported that C1-Ten preferentially dephosphorylated IRS-1 Y612 during insulin signaling [13]. To further investigate the molecular mechanism underlying this function of C1-Ten, we examined the insulin-induced time-course effect of phosphorylation in L6 myoblasts. C1-Ten-silenced cells showed significantly increased levels of phosphorylation on IRS-1 Y612 (Fig. 1A) during insulin stimulation. The amount of total IRS-1 was not altered by C1-Ten knockdown and the phospho-IRS-1 Y612 level increased throughout insulin stimulation and decreased 60 min after stimulation. Phosphorylation of Akt at T308 and S473, a downstream target of IRS-1, increased significantly after 5 min and 15 min, respectively, of insulin treatment in C1-Ten-silenced cells. This result suggests that C1-Ten-mediated dephosphorylation of IRS-1 Y612 contributed to reduced phosphorylation of Akt at both sites. To corroborate the observed increase of phospho-IRS-1 Y612 and phospho-Akt (T308 and S473) in C1-Ten-silenced cells, distinct non-overlapping siRNAs against C1-Ten (siC1-Ten 2) were tested (Fig. S1). We confirmed a consistent increase in phospho-IRS-1 Y612 and phospho-Akt T308 and S473 during an insulin-induced time-course in C1-Ten-silenced cells using distinct siRNA. These results suggest that a reduction of IRS-1 Y612 phosphorylation in response to insulin is not due to other factors (e.g., off-target effects of the siRNA), but is linked to the function of C1-Ten. To determine the putative signaling pathways affected by C1-Ten and involved in IRS-1 Y612 phosphorylation, we pretreated the endogenous C1-Ten-expressing L6 myoblasts with a PI3K inhibitor, LY294002. Interestingly, insulin-induced IRS-1 Y612 phosphorylation was upregulated in the presence of LY294002 (Fig. 1B). These results suggest that IRS-1 Y612 dephosphorylation by C1-Ten is regulated by PI3K activity. To further test this notion, we measured the effect of overexpressing C1-Ten in the presence and absence of LY294002 in the HEK293 cell line, which expresses low levels of C1-Ten [20]. As shown in Fig. 1C, C1-Ten overexpression in HEK293 cells resulted in the successful dephosphorylation of IRS-1 Y612. Conversely, IRS-1 Y612 phosphorylation was restored in the presence of LY294002 in C1-Ten-overexpressing HEK293 cells. Collectively, these results indicate that PI3K activity is involved in the regulation of C1-Ten, which appears to function as a PTP in insulin signaling.

Figure 1. The role of C1-Ten in insulin signaling is phosphoinositide 3-kinase (PI3K)-dependent.

Figure 1.

Figure 1.

Open in a new tab

(A) Time-course effect of C1-Ten knockdown on insulin receptor substrate-1 (IRS-1)-mediated insulin signaling in L6 myoblasts. Cells were transfected with 100 nM siRNA control (siCon) or targeting C1-Ten siRNA1 (siC1-Ten). After 24 h, cells were serum-starved for 4 h and stimulated with 50 nM insulin for the indicated time periods. Cell lysates were analyzed by immunoblotting with the indicated antibodies. Levels of total IRS-1 protein are relative to those of actin. The phospho-immunoblot was normalized to the corresponding total protein immunoblot and quantified as the relative fold change compared to siCon’s initial values. Data are presented as mean ± SEM (n = 4). *P < 0.05, **P < 0.01, ***P < 0.001. (B) Time-course effect of LY294002 on IRS-1-mediated insulin signaling in L6 myoblasts. Cells were serum-starved for 4 h and pretreated with dimethyl sulfoxide (DMSO) or 50 μM LY294002 for 30 min prior to stimulation with 50 nM insulin for the indicated time periods. Cell lysates were analyzed by immunoblotting with the indicated antibodies. Data are presented as mean ± SEM (n = 3). **P < 0.01. (C) Effect of LY294002 on IRS-1-mediated insulin signaling in HEK293 cells. Cells were transfected with Flag-VEC or Flag-C1-Ten wild-type (WT) and serum-starved for 18 h, and pretreated with DMSO or 10 μM LY294002 for 2 h prior to stimulation with 5 nM insulin for 5 min. Cell lysates were analyzed by immunoblotting with the indicated antibodies. Data are presented as mean ± SEM (n = 4). **P < 0.01, ***P < 0.001.

3.2. C1-Ten SH2 domain affects PtdIns(3,4,5)P3 binding

Our present results indicate that the dephosphorylation of IRS-1 Y612 by C1-Ten is PI3K-dependent. We previously reported that most human SH2 domains can bind lipids with high affinity and specificity, which is essential for cellular signaling activities of their host proteins [19, 21]. We thus tested if PI3K-dependent dephosphorylation of IRS-1 Y612 by C1-Ten was dependent on the lipid-binding activity of its SH2 domain. In particular, we examined if the C1-Ten SH2 domain could specifically interact with the products of PI3K by quantitatively measuring PtdInsP selectivity for the C1-Ten SH2 domain. Indeed, the C1-Ten SH2 domain exhibited selectivity for two lipid products of PI3K, PtdIns(3,4,5)P3 and PtdIns(3,4)P2. In particular, its ability to distinguish among three iso-electric bisphophates, PtdIns(3,4)P2, PtdIns(4,5)P2 and PtdIns(3,5)P2, underscored the specific nature of its lipid binding. For PtdIns(3,4,5)P3-containing vesicles, C1-Ten-SH2 showed a Kd of 260 ± 40 nM (Fig. 2A and B), which was comparable to that of the Akt1 PH domain [22], a canonical PtdIns(3,4,5)P3-and PtdIns(3,4)P2-binding domain [23]. Collectively, these results show that the C1-Ten SH2 domain is a genuine PtdIns(3,4,5)P3- (and PtdIns(3,4)P2-)binding domain and suggest that PI3K modulates C1-Ten activity through PtdIns(3,4,5)P3-SH2 domain interaction during insulin signaling.

Figure 2. C1-Ten SH2 domain binds specifically to phosphatidylinositol-3,4,5-trisphosphate (PtdIns(3,4,5)P3).

Figure 2.

Open in a new tab

(A-B) All SPR measurements were performed at 25 °C in SPR running buffer containing 20 mM TrisHCl (pH 7.4) and 160 mM NaCl. POPC vesicles were used for the control surface. (A) Phosphoinositide specificity of the C1-Ten SH2 domain. The C1-Ten SH2 domain (500 nM) was allowed to interact with POPC/POPS/PtdInsP (77:20:3) vesicles using the L1 chip. Sensorgrams show PtdIns(3,4,5)P3 > PtdIns(3,4)P2 > PtdIns(4,5)P2 > PtdIns(3)P ~ PtdIns(3,5)P2 ~ PtdIns(5)P ~ PtdIns(4)P (from top to bottom). (B) Determination of Kd for PtdIns(3,4,5)P3 vesicles of the C1-Ten SH2 domain. The C1-Ten SH2 domain was injected at 5 μl/min at varying concentrations (10, 30, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, and 1000 nM, from bottom to top) over the L1 chip coated with PtdIns(3,4,5)P3 vesicles (left). Binding isotherms were generated from the Req versus the concentration (Po) of the C1-Ten SH2 domain plot (right). Solid lines indicate the theoretical curve constructed from Rmax (= 5234 ± 285) and Kd (= 260 ± 40) values.

3.3. The lipid-binding site of C1-Ten SH2 is topologically distinct from its canonical pY-binding site

We previously reported that most SH2 domains contained surface cationic patches and grooves involved in lipid binding. The location of these sites is highly variable but in general spatially separated from their canonical pY-binding pockets [19, 21]. Examination of a solubilized NMR structure of C1-Ten-SH2 revealed that it also possessed a prominent cationic patch containing K1147, K1155, and K1157, which was distant from its pY-binding pocket [24] (Fig. 3A) and might be involved in PtdIns(3,4,5)P3 binding. We thus sequentially mutated these cationic residues to K1157Q, K1155Q/K1157Q, K1142Q/K1157Q, and K1142Q/K1155Q/K1157Q to determine if they were involved in PtdIns(3,4,5)P3 binding (Fig. 3B). In general, mutation of these residues reduced the affinity of C1-Ten SH2 for PtdIns(3,4,5)P3-containing vesicles, with a triple-site mutant (K1142Q/K1155Q/K1157Q; referred to as 3KQ hereafter) showing the lowest affinity. Equilibrium SPR analysis revealed that 3KQ had 6-fold lower affinity for PtdIns(3,4,5)P3 vesicles than the WT (Fig. 3C). Also, 3KQ had much lower selectivity for PtdIns(3,4,5)P3 over PtdIns(4,5)P2 vesicles than the WT (Fig. 3D), supporting the notion that the mutated residues were involved in specific PtdIns(3,4,5)P3 binding. As a negative control, we mutated cationic residues in other parts of the C1-Ten SH2 domain (i.e., K1209, K1212, and K1214) (Fig. S2A) and none significantly affected its binding to PtdIns(3,4,5)P3 vesicles (Fig. S2B). We also mutated a conserved cationic residue in the pY-binding pocket of C1-Ten SH2 (R1165A) but no significant difference was observed between WT and the mutant in terms of binding to PtdIns(3,4,5)P3containing vesicles (Fig. 3E), confirming that the pY pocket was not involved in lipid binding. Taken together, these data indicate that K1142, K1155, and K1157 in the main cationic patch are involved in specific PtdIns(3,4,5)P3 binding to the C1-Ten SH2 domain.

Figure 3. The K1142, K1155, and K1157 residues of the C1-Ten SH2 domain are involved in PtdIns(3,4,5)P3 binding.

Figure 3.

Figure 3.

Open in a new tab

(A) Structure of the C1-Ten SH2 domain according to an electrostatic surface model. The model shows the pY-binding pocket containing R1165 and lipid-binding residues K1142, K1155, and K1157. Note that the putative lipid-binding residues are topologically distinct from the pY-binding pocket. (B) PtdIns(3,4,5)P3 binding values of the cationic patch of C1-Ten SH2 domain as determined by SPR analysis. The WT, K1157Q, K1142Q/K1157Q, K1155Q/K1157Q, and K1142Q/K1155Q/K1157Q (3KQ) mutant C1-Ten SH2 domain was allowed to interact with POPC/POPS/PtdIns(3,4,5)P3 (77:20:3) vesicles. (C) Determination of Kd for PtdIns(3,4,5)P3 vesicles of the 3KQ mutation of C1-Ten SH2 domain by SPR analysis. The C1-Ten SH2 3KQ was injected at 5 μl/min at varying concentrations (10, 30, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, and 1000 nM, from bottom to top) over the L1 chip coated with PtdIns(3,4,5)P3 vesicles (left). Binding isotherms were generated from Req versus concentration (Po) of the C1-Ten SH2 3KQ plot (right). Solid lines indicate the theoretical curve constructed from Rmax (941 ± 79) and Kd (1260 ± 128) values. (D) PtdIns(3,4,5)P3 and PtdIns(4,5)P2 binding of the WT and 3KQ C1-Ten SH2 by SPR analysis. The WT and 3KQ mutant C1-Ten SH2 domains were allowed to interact with POPC/POPS/PtdInsP (77:20:3) vesicles. (E) PtdIns(3,4,5)P3 binding values for the C1-Ten SH2 domain in WT and R1165A mutant as determined by SPR analysis. WT and R1165A C1-Ten SH2 were allowed to interact with POPC/POPS/PtdIns(3,4,5)P3 (77:20:3) vesicles. (F) Affinity of WT, 3KQ, and R1165A C1-Ten SH2 to a pY-containing peptide (F-Ahx-NEpYDNV; 50 nM) was measured by fluorescence anisotropy. WT (Kd = 2.5 ± 1.3 μM) and 3KQ (Kd = 3.6 ± 1.4 μM) showed comparable affinities, whereas R1165A exhibited a ~36-fold decrease in affinity (Kd = 90.9 ± 11.4 μM). Pepbound and Pepo indicate the concentration of bound peptide and total peptide, respectively. *P < 0.05, **P < 0.01, n.s., not significant.

The 3KQ mutation of C1-Ten SH2 is not expected to alter its primary function as a pY motif-binding module, because the lipid-binding sites and pY-binding site are spatially separated. Prior to performing cell studies using 3KQ, we thus checked if this mutation might have affected its binding to a pY motif [25]. Binding analysis using a fluorescein-labeled pY peptide by fluorescence anisotropy showed that the WT and 3KQ C1-Ten SH2 domains exhibited essentially the same affinity for the peptide while R1165A showed much reduced peptide affinity (Fig. 3F), confirming the spatial and functional orthogonality of the lipid- and pY-binding sites.

3.4. The lipid-binding motif of C1-Ten is essential for its biological function

Lipids regulate cellular activities of cytosolic proteins either by controlling their subcellular localization [26, 27] or by modulating their conformation and function [28]. To determine whether PtdIns(3,4,5)P3 controls in the membrane translocation of C1-Ten, we measured the plasma membrane localization of WT and 3KQ C1-Ten in response to insulin signaling, using TIRF imaging. TIRF microscopy is well suited for analysis of the localization and dynamics of molecules near the plasma membrane [29]. As shown in Fig. 4A, both WT and 3KQ C1-Ten are significantly pre-localized in the plasma membrane before insulin localization, and thus showed little to no change in localization after insulin stimulation. In contrast, the Akt PH domain, used as a positive control, showed a significant increase in TIRF signal after insulin stimulation.

Figure 4. The PtdIns(3,4,5)P3 binding motif of C1-Ten is essential for cellular phosphatase activity.

Figure 4.

Figure 4.

Open in a new tab

(A) Localization of WT and 3KQ mutant C1-Ten in HEK293 cells was determined by TIRF microscopy. HEK293 cells transfected with EGFP-tagged C1-Ten WT, C1-Ten 3KQ mutant, and Akt PH domain (as positive control) were starved for 18 h. The time elapsed after stimulation with 10 nM insulin is shown on each image. Scale bars: 20 μm. Fluorescence intensity changes at different times after insulin stimulation are quantified. Graphs represent average fluorescence intensity from each cell normalized to the non-stimulation time point. Data are presented as mean ± SEM from three independent experiments. n.s., not significant. (B) In vitro PTP activity of WT and 3KQ C1-Ten. Ponceau S staining revealed the quantity, integrity, and purity of full-length WT and 3KQ C1-Ten (left). A malachite green assay was performed with C1-Ten WT and 3KQ mutant and 400 μM EEEEpYEEEE peptide. Assays were repeated three times in duplicate. Data are presented as mean ± SEM (n = 3) (right). (C) Effect of PtdIns(3,4,5)P3 binding on IRS-1-mediated insulin signaling in HEK293 cell lines stably expressing Flag-C1-Ten WT or Flag-C1-Ten 3KQ. Cells were serum-starved for 18 h and stimulated with 5 nM insulin for 5 min. Cell lysates were subjected to immunoblotting with the indicated antibodies. Data are presented as mean ± SEM (n = 4). **P < 0.01, ***P < 0.001. (D) A proposed model: interaction of C1-Ten with PtdIns(3,4,5)P3 mediates IRS-1 dephosphorylation.

We then investigated whether or not PtdIns(3,4,5)P3 modulates the functional activity of C1Ten in cells. To determine whether the C1-Ten 3KQ mutant was catalytically intact, we first performed an in vitro PTP assay. WT and 3KQ C1-Ten displayed similar PTP activity (Fig. 4B), indicating that the 3KQ mutation of C1-Ten does not alter its intrinsic PTP activity. We then compared the activity of WT and 3KQ C1-Ten in a stable expression system. As shown in Fig. 4C, the phosphorylation levels of IRS-1 Y612, Akt T308 and S473 upon insulin stimulation were much lower in WT C1-Ten-expressing cells than in C1-Ten 3KQ-expressing cells. This means that despite its fully intact PTP activity, 3KQ with compromised PtdIns(3,4,5)P3 binding activity cannot perform its signaling function in the cells. These results thus show that recognition of PtdIns(3,4,5)P3 by the C1-Ten SH2 domain is essential for the cellular signaling function of C1-Ten.

4. Discussion

Strength and duration of insulin signaling are determined largely by the coordinated actions of tyrosine kinases and phosphatases. Indeed, abnormal regulation of tyrosine phosphorylation at the molecular level can lead to diseases such as diabetes. IRS-1 is phosphorylated at multiple tyrosine residues upon insulin stimulation; these sites serve as docking points to recruit downstream molecules, many of which contain SH2 domains [30]. Phosphorylation of IRS-1 Y612 generates a major docking site for PI3K, which is associated with its full activity [31] and plays a central role in recruitment of important downstream signal transduction cascades (e.g., PI3K-PKB/Akt pathway) [32]. C1-Ten is the only physiologically relevant PTP for the dephosphorylation of IRS-1 Y612 [13]. However, it remains unclear how C1-Ten regulates IRS-1 Y612 phosphorylation in the insulin signaling pathway. In this study, we determined the effect of PI3K activity on IRS-1 Y612 phosphorylation in the absence or presence of C1-Ten in different cell lines (Fig. 1). Inhibition of the PI3K activity increased phosphorylation of IRS-1 Y612 in L6 myoblasts, which contain a high level of endogenous C1-Ten, but not in HEK293 cells, in which endogenous C1-Ten levels are low. To determine whether C1-Ten’s role was dependent on PI3K activity, we overexpressed C1-Ten in HEK293 cells and observed a significant decrease in IRS-1 Y612 phosphorylation. Also, inhibition of PI3K activity restored the phosphorylation level of IRS-1 Y612 in C1-Tenoverexpressing HEK293 cells. These results suggest a negative feedback mechanism for PI3K-dependent IRS-1 Y612 dephosphorylation mediated by C1-Ten. Additionally, increased intensity of IRS-1 Y612 phosphorylation in C1-Ten knockdown L6 myoblasts indicates that insulin dependency was improved with the decrease of C1-Ten level. Collectively, these results establish that IRS-1 serves as a phosphorylation-sensitive rheostat to control the strength of insulin signaling and that its tyrosine dephosphorylation is regulated by C1-Ten in a PI3K-dependent manner.

PTPs play a key role in regulating the steady-state of reversible tyrosine phosphorylation events in the insulin pathway [3]. Many studies have shown that human PTP-based protein interaction networks transduce and regulate a wide range of PTP-related cellular functions [33–35]. For example, PTP1B and SHP-2 are known to regulate the insulin signaling pathway by modulating tyrosine phosphorylation of the insulin receptor itself and/or IRS-1, as well as the binding of SH2 domain-containing adaptor proteins to IRS-1 [36–38]. Lipids play important roles in modulating cellular activities [19, 21, 39–41]. However, lipid-mediated regulation of PTP activity is not well understood. This study shows that the PtdIns(3,4,5)P3-binding activity of C1-Ten is important for its cellular PTP activity. C1-Ten affects IRS-1 Y612 phosphorylation only through direct interaction with IRS-1 [13]. Because the catalytic domain of PTPs lacks substrate specificity, their substrate specificity is typically achieved through specific interaction with a substrate protein individually or within a multi-protein signaling complex [42], Likewise, specific interaction between the two molecule would be necessary for the specificity of C1-Ten towards IRS-1. The exact mechanism of the direct interaction between C1-Ten and IRS-1 is not fully elucidated, but such interaction is reduced in the presence of vanadate, a phosphotyrosine mimetic [13], suggesting the involvement of pY binding. Interestingly, the lipid-binding-deficient C1-Ten 3KQ mutant retained pY-binding activity and intrinsic phosphatase activity but did not exhibit intracellular PTP activity, suggesting that the C1-Ten-IRS-1 interaction is affected by lipid binding. In response to insulin stimulation, IRS-1 approaches the plasma membrane, where it binds to the insulin receptor [43, 44]. For C1-Ten to interact with IRS-1, both should come close to the plasma membrane. However, C1-Ten is pre-localized in the plasma membrane before insulin stimulation and thus shows no further increase in TIRF signal after insulin stimulation (Fig. 4A). Accordingly, the main role of PtdIns(3,4,5)P3 is likely to coordinate the IRS-1-C1-Ten interaction through allosteric effects as shown in our previous report [21]. Undoubtedly, further studies are required to elucidate the complex mechanism by which PtdIns(3,4,5)P3 regulates C1-Ten PTP activity by specifically facilitating its interaction with IRS-1.

C1-Ten has two phosphotyrosine binding modules, the SH2 and PTB domain. Studies on the role of C1-Ten in signaling are based mainly on work about the C-terminal region of C1-Ten, which includes these two domains [5, 10, 45, 46]. These domains are essential for interaction and regulation of their binding partners. Subsequent studies have shown that, while binding of the SH2 domain to target proteins is strictly regulated by tyrosine phosphorylation, most PTB domains bind to their nonphosphorylated targets in a constitutive manner [47]. Unlike other tensin family, C1-Ten uses the PTB domain predominantly to regulate DLC-1 activity [11] and bind to the pY motif on integrin [6] whereas it employs the SH2 domain to regulate DLC-1 in a pY-independent manner [48]. Thus, the C1-Ten SH2 domain may have other properties beyond passive pY-binding. Accumulating evidence suggests that SH2 domains are dual-specificity lipid- and protein-binding modules utilizing alternative cationic patches that are structurally and functionally independent from their canonical pY-binding pockets [19, 21, 49, 50]. Our study shows that the C1-Ten SH2 domain interact with lipids—especially PtdIns(3,4,5)P3—via its prominent alternate cationic patches rather than its pY-binding pocket. This may enable C1-Ten to simultaneously interact with lipids and the pY motif using two separate sites, allowing lipids to allosterically coordinate and modulate its pY-binding activity and specificity [19]. The C1-Ten SH2 domain has been implicated in binding to a number of signaling proteins that regulate cell migration [48, 51, 52]; however, its involvement in insulin signaling, through specific interactions with the components of the major signaling pathways has not been thoroughly investigated. In this study, a good correlation between in vitro lipid-binding properties of the C1-Ten SH2 domain and various cellular activities of C1-Ten shows that the lipid-binding activity of the SH2 domain is essential for the PTP activity of C1-Ten in insulin signaling. Although further studies are required to elucidate the interplay of the SH2 domain and other parts of C1-Ten in its signaling activities, our results suggest that dual lipid- and pY-binding activity of the C1-Ten SH2 domain is a crucial element in the spatiotemporal regulation of the cellular C1-Ten activity.

5. Conclusions

Our study identified a novel type of C1-Ten regulation mediated by interactions with PtdIns(3,4,5)P3 via the SH2 domain, which allows for its interaction with tyrosine-phosphorylated IRS-1, as summarized in Fig. 4D. Our results suggest that C1-Ten acts as a spatiotemporal negative regulator in insulin signaling. The delicate regulation of C1-Ten potentially improves the specificity for IRS-1 and tightly controls its phosphorylation level in the insulin signaling pathway.

Supplementary Material

1

Supplementary Figure 1. Time-course effect of C1-Ten (siRNA 2) knockdown on insulin receptor substrate-1 (IRS-1)-mediated insulin signaling in L6 myoblasts.

Cells were transfected with 100 nM siRNA control (siCon) or targeting C1-Ten siRNA (siC1-Ten 2). After 24 h, cells were serum-starved for 4 h and stimulated with 50 nM insulin for the indicated time periods. Cell lysates were analyzed by immunoblotting with the indicated antibodies. Levels of total IRS-1 protein relative to those of actin. The phospho-immunoblot was normalized to the corresponding total protein immunoblot and quantified as the relative fold change compared to the siCon’s initial values. Data are presented as mean ± SEM (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001.

Supplementary Figure 2. Control cationic residues on the C1-Ten SH2 domain do not bind to PtdIns(3,4,5)P3.

(A) Structure of C1-Ten SH2 domain residues K1209, K1212, and K1214. (B) PtdIns(3,4,5)P3 binding values of the control cationic patch of C1-Ten-SH2 by SPR analysis. WT and K1209Q/K1212Q/K12147Q (3KQ) mutant C1-Ten-SH2 were allowed to interact with POPC/POPS/PtdIns(3,4,5)P3 (77:20:3) vesicles.

Highlights.

  • C1-Ten’s function as a PTP for IRS-1 in insulin signaling is controlled by PI3K.

  • The C1-Ten SH2 domain binds to PtdIns(3,4,5)P3 with high affinity.

  • The PtdIns(3,4,5)P3 binding of C1-Ten is necessary for its function as PTP.

Acknowledgements

The authors would like to thank Editage (https://www.editage.co.kr) for the English language review.

Funding

This work was supported by Global Research Laboratory (GRL) Program (SHR) through the National Research Foundation of Korea (NRF) funded by the Ministry of Science, ICT (No. NRF-2016K1A1A2912722) (SHR), and by a National Institutes of Health grant, R35GM122530 (WC).

Abbreviations

PTP

protein tyrosine phosphatase

IRS-1

insulin receptor substrate-1

PI3K

phosphoinositide 3-kinase

C1-Ten

C1 domain-containing phosphatase and tensin homolog

SH2

Src-homology 2

PtdIns(3,4,5)P3

phosphatidylinositol-3,4,5-triphosphate

SPR

surface plasmon resonance

Footnotes

Declaration of interest: None

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Boucher J, Kleinridders A, Kahn CR: Insulin receptor signaling in normal and insulin-resistant states. Cold Spring Harbor perspectives in biology 2014, 6(1). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.White MF: IRS proteins and the common path to diabetes. American journal of physiology Endocrinology and metabolism 2002, 283(3):E413–422. [DOI] [PubMed] [Google Scholar]
  • 3.Goldstein BJ, Ahmad F, Ding W, Li PM, Zhang WR: Regulation of the insulin signalling pathway by cellular protein-tyrosine phosphatases. Molecular and cellular biochemistry 1998, 182(1–2):91–99. [PubMed] [Google Scholar]
  • 4.Calderwood DA, Fujioka Y, de Pereda JM, Garcia-Alvarez B, Nakamoto T, Margolis B, McGlade CJ, Liddington RC, Ginsberg MH: Integrin beta cytoplasmic domain interactions with phosphotyrosine-binding domains: a structural prototype for diversity in integrin signaling. Proceedings of the National Academy of Sciences of the United States of America 2003, 100(5):2272–2277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hafizi S, Alindri F, Karlsson R, Dahlback B: Interaction of Axl receptor tyrosine kinase with C1-TEN, a novel C1 domain-containing protein with homology to tensin. Biochemical and biophysical research communications 2002, 299(5):793–800. [DOI] [PubMed] [Google Scholar]
  • 6.Lo SH: Tensin. The international journal of biochemistry & cell biology 2004, 36(1):31–34. [DOI] [PubMed] [Google Scholar]
  • 7.Hafizi S, Ibraimi F, Dahlback B: C1-TEN is a negative regulator of the Akt/PKB signal transduction pathway and inhibits cell survival, proliferation, and migration. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2005, 19(8):971–973. [DOI] [PubMed] [Google Scholar]
  • 8.Hafizi S, Gustafsson A, Oslakovic C, Idevall-Hagren O, Tengholm A, Sperandio O, Villoutreix BO, Dahlback B: Tensin2 reduces intracellular phosphatidylinositol 3,4,5-trisphosphate levels at the plasma membrane. Biochemical and biophysical research communications 2010, 399(3):396–401. [DOI] [PubMed] [Google Scholar]
  • 9.Jung AS, Kaushansky A, Macbeath G, Kaushansky K: Tensin2 is a novel mediator in thrombopoietin (TPO)-induced cellular proliferation by promoting Akt signaling. Cell cycle 2011, 10(11):1838–1844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yam JW, Ko FC, Chan CY, Jin DY, Ng IO: Interaction of deleted in liver cancer 1 with tensin2 in caveolae and implications in tumor suppression. Cancer research 2006, 66(17):8367–8372. [DOI] [PubMed] [Google Scholar]
  • 11.Chan LK, Ko FC, Ng IO, Yam JW: Deleted in liver cancer 1 (DLC1) utilizes a novel binding site for Tensin2 PTB domain interaction and is required for tumor-suppressive function. PloS one 2009, 4(5):e5572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Lee J, Koh A, Jeong H, Kim E, Ha TS, Saleem MA, Ryu SH: C1-Ten is a PTPase of nephrin, regulating podocyte hypertrophy through mTORC1 activation. Scientific reports 2017, 7(1):12346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Koh A, Lee MN, Yang YR, Jeong H, Ghim J, Noh J, Kim J, Ryu D, Park S, Song P et al. : C1-Ten is a protein tyrosine phosphatase of insulin receptor substrate 1 (IRS-1), regulating IRS-1 stability and muscle atrophy. Molecular and cellular biology 2013, 33(8):1608–16l20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Jeong H, Koh A, Lee J, Park D, Lee JO, Lee MN, Jo KJ, Tran HNK, Kim E, Min BS et al. : Inhibition of C1-Ten PTPase activity reduces insulin resistance through IRS-1 and AMPK pathways. Scientific reports 2017, 7(1):17777. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Koh A, Park D, Jeong H, Lee J, Lee MN, Suh PG, Ryu SH: Regulation of C1-Ten protein tyrosine phosphatase by p62/SQSTM1-mediated sequestration and degradation. Cellular signalling 2014, 26(11):2470–2480. [DOI] [PubMed] [Google Scholar]
  • 16.Stahelin RV, Rafter JD, Das S, Cho W: The molecular basis of differential subcellular localization of C2 domains of protein kinase C-alpha and group IVa cytosolic phospholipase A2. The Journal of biological chemistry 2003, 278(14):12452–12460. [DOI] [PubMed] [Google Scholar]
  • 17.Ananthanarayanan B, Stahelin RV, Digman MA, Cho W: Activation mechanisms of conventional protein kinase C isoforms are determined by the ligand affinity and conformational flexibility of their C1 domains. The Journal of biological chemistry 2003, 278(47):46886–46894. [DOI] [PubMed] [Google Scholar]
  • 18.Cho W, Bittova L, Stahelin RV: Membrane binding assays for peripheral proteins. Analytical biochemistry 2001, 296(2):153–161. [DOI] [PubMed] [Google Scholar]
  • 19.Park MJ, Sheng R, Silkov A, Jung DJ, Wang ZG, Xin Y, Kim H, Thiagarajan-Rosenkranz P, Song S, Yoon Y et al. : SH2 Domains Serve as Lipid-Binding Modules for pTyr-Signaling Proteins. Molecular cell 2016, 62(1):7–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Martuszewska D, Ljungberg B, Johansson M, Landberg G, Oslakovic C, Dahlback B, Hafizi S: Tensin3 is a negative regulator of cell migration and all four Tensin family members are downregulated in human kidney cancer. PloS one 2009, 4(2):e4350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sheng R, Jung DJ, Silkov A, Kim H, Singaram I, Wang ZG, Xin Y, Kim E, Park MJ, Thiagarajan-Rosenkranz P et al. : Lipids regulate Lck activity through their interactions with the Lck SH2 domain. The Journal of biological chemistry 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Manna D, Albanese A, Park WS, Cho W: Mechanistic basis of differential cellular responses of phosphatidylinositol 3,4-bisphosphate- and phosphatidylinositol 3,4,5-trisphosphate-binding pleckstrin homology domains. The Journal of biological chemistry 2007, 282(44):32093–32105. [DOI] [PubMed] [Google Scholar]
  • 23.Cho W, Stahelin RV: Membrane-protein interactions in cell signaling and membrane trafficking. Annual review of biophysics and biomolecular structure 2005, 34:119–151. [DOI] [PubMed] [Google Scholar]
  • 24.Chen L, Liu C, Rui F, Zhu G: 1H, 15N and 13C chemical shift assignments of the SH2 domain of human tensin2 (TENC1). Biomolecular NMR assignments 2011, 5(2):211–214. [DOI] [PubMed] [Google Scholar]
  • 25.Pawson T: Specificity in signal transduction: from phosphotyrosine-SH2 domain interactions to complex cellular systems. Cell 2004, 116(2):191–203. [DOI] [PubMed] [Google Scholar]
  • 26.Lemmon MA: Membrane recognition by phospholipid-binding domains. Nature reviews Molecular cell biology 2008, 9(2):99–111. [DOI] [PubMed] [Google Scholar]
  • 27.van Meer G, Voelker DR, Feigenson GW: Membrane lipids: where they are and how they behave. Nature reviews Molecular cell biology 2008, 9(2):112–124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Campbell RB, Liu F, Ross AH: Allosteric activation of PTEN phosphatase by phosphatidylinositol 4,5-bisphosphate. The Journal of biological chemistry 2003, 278(36):33617–33620. [DOI] [PubMed] [Google Scholar]
  • 29.Mattheyses AL, Simon SM, Rappoport JZ: Imaging with total internal reflection fluorescence microscopy for the cell biologist. Journal of cell science 2010, 123(Pt 21):3621–3628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Gual P, Le Marchand-Brustel Y, Tanti JF: Positive and negative regulation of insulin signaling through IRS-1 phosphorylation. Biochimie 2005, 87(1):99–109. [DOI] [PubMed] [Google Scholar]
  • 31.Esposito DL, Li Y, Cama A, Quon MJ: Tyr(612) and Tyr(632) in human insulin receptor substrate-1 are important for full activation of insulin-stimulated phosphatidylinositol 3-kinase activity and translocation of GLUT4 in adipose cells. Endocrinology 2001, 142(7):2833–2840. [DOI] [PubMed] [Google Scholar]
  • 32.Hemmings BA, Restuccia DF: PI3K-PKB/Akt pathway. Cold Spring Harbor perspectives in biology 2012, 4(9):a011189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Li X, Tran KM, Aziz KE, Sorokin AV, Chen J, Wang W: Defining the Protein-Protein Interaction Network of the Human Protein Tyrosine Phosphatase Family. Molecular & cellular proteomics : MCP 2016, 15(9):3030–3044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tonks NK, Neel BG: Combinatorial control of the specificity of protein tyrosine phosphatases. Current opinion in cell biology 2001, 13(2):182–195. [DOI] [PubMed] [Google Scholar]
  • 35.Zhang ZY, Maclean D, McNamara DJ, Sawyer TK, Dixon JE: Protein tyrosine phosphatase substrate specificity: size and phosphotyrosine positioning requirements in peptide substrates. Biochemistry 1994, 33(8):2285–2290. [DOI] [PubMed] [Google Scholar]
  • 36.Egawa K, Maegawa H, Shimizu S, Morino K, Nishio Y, Bryer-Ash M, Cheung AT, Kolls JK, Kikkawa R, Kashiwagi A: Protein-tyrosine phosphatase-1B negatively regulates insulin signaling in l6 myocytes and Fao hepatoma cells. The Journal of biological chemistry 2001, 276(13):10207–10211. [DOI] [PubMed] [Google Scholar]
  • 37.Goldstein BJ, Bittner-Kowalczyk A, White MF, Harbeck M: Tyrosine dephosphorylation and deactivation of insulin receptor substrate-1 by protein-tyrosine phosphatase 1B. Possible facilitation by the formation of a ternary complex with the Grb2 adaptor protein. The Journal of biological chemistry 2000, 275(6):4283–4289. [DOI] [PubMed] [Google Scholar]
  • 38.Myers MG Jr., Mendez R, Shi P, Pierce JH, Rhoads R, White MF: The COOH-terminal tyrosine phosphorylation sites on IRS-1 bind SHP-2 and negatively regulate insulin signaling. The Journal of biological chemistry 1998, 273(41):26908–26914. [DOI] [PubMed] [Google Scholar]
  • 39.Chen Y, Sheng R, Kallberg M, Silkov A, Tun MP, Bhardwaj N, Kurilova S, Hall RA, Honig B, Lu H et al. : Genome-wide functional annotation of dual-specificity protein- and lipid-binding modules that regulate protein interactions. Molecular cell 2012, 46(2):226–237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sheng R, Chen Y, Yung Gee H, Stec E, Melowic HR, Blatner NR, Tun MP, Kim Y, Kallberg M, Fujiwara TK et al. : Cholesterol modulates cell signaling and protein networking by specifically interacting with PDZ domain-containing scaffold proteins. Nature communications 2012, 3:1249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sheng R, Kim H, Lee H, Xin Y, Chen Y, Tian W, Cui Y, Choi JC, Doh J, Han JK et al. : Cholesterol selectively activates canonical Wnt signalling over non-canonical Wnt signalling. Nature communications 2014, 5:4393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Mauro LJ, Dixon JE: ‘Zip codes’ direct intracellular protein tyrosine phosphatases to the correct cellular ‘address’. Trends in biochemical sciences 1994, 19(4):151–155. [DOI] [PubMed] [Google Scholar]
  • 43.Razzini G, Ingrosso A, Brancaccio A, Sciacchitano S, Esposito DL, Falasca M: Different subcellular localization and phosphoinositides binding of insulin receptor substrate protein pleckstrin homology domains. Molecular endocrinology 2000, 14(6):823–836. [DOI] [PubMed] [Google Scholar]
  • 44.Eck MJ, Dhe-Paganon S, Trub T, Nolte RT, Shoelson SE: Structure of the IRS-1 PTB domain bound to the juxtamembrane region of the insulin receptor. Cell 1996, 85(5):695–705. [DOI] [PubMed] [Google Scholar]
  • 45.Goudarzi S, Smith LJ, Schutz S, Hafizi S: Interaction of DISC1 with the PTB domain of Tensin2. Cellular and molecular life sciences : CMLS 2013, 70(9):1663–1672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Moon KD, Zhang X, Zhou Q, Geahlen RL: The protein-tyrosine kinase Syk interacts with the C-terminal region of tensin2. Biochimica et biophysica acta 2012, 1823(2):199–205. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Schlessinger J, Lemmon MA: SH2 and PTB domains in tyrosine kinase signaling. Science’s STKE : signal transduction knowledge environment 2003, 2003(191):RE12. [DOI] [PubMed] [Google Scholar]
  • 48.Liao YC, Si L, deVere White RW, Lo SH: The phosphotyrosine-independent interaction of DLC-1 and the SH2 domain of cten regulates focal adhesion localization and growth suppression activity of DLC-1. The Journal of cell biology 2007, 176(1):43–49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Rameh LE, Chen CS, Cantley LC: Phosphatidylinositol (3,4,5)P3 interacts with SH2 domains and modulates PI 3-kinase association with tyrosine-phosphorylated proteins. Cell 1995, 83(5):821–830. [DOI] [PubMed] [Google Scholar]
  • 50.Bae JH, Lew ED, Yuzawa S, Tome F, Lax I, Schlessinger J: The selectivity of receptor tyrosine kinase signaling is controlled by a secondary SH2 domain binding site. Cell 2009, 138(3):514–524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Clark K, Howe JD, Pullar CE, Green JA, Artym VV, Yamada KM, Critchley DR: Tensin 2 modulates cell contractility in 3D collagen gels through the RhoGAP DLC1. Journal of cellular biochemistry 2010, 109(4):808–817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Wavreille AS, Pei D: A chemical approach to the identification of tensin-binding proteins. ACS chemical biology 2007, 2(2):109–118. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

Supplementary Figure 1. Time-course effect of C1-Ten (siRNA 2) knockdown on insulin receptor substrate-1 (IRS-1)-mediated insulin signaling in L6 myoblasts.

Cells were transfected with 100 nM siRNA control (siCon) or targeting C1-Ten siRNA (siC1-Ten 2). After 24 h, cells were serum-starved for 4 h and stimulated with 50 nM insulin for the indicated time periods. Cell lysates were analyzed by immunoblotting with the indicated antibodies. Levels of total IRS-1 protein relative to those of actin. The phospho-immunoblot was normalized to the corresponding total protein immunoblot and quantified as the relative fold change compared to the siCon’s initial values. Data are presented as mean ± SEM (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001.

Supplementary Figure 2. Control cationic residues on the C1-Ten SH2 domain do not bind to PtdIns(3,4,5)P3.

(A) Structure of C1-Ten SH2 domain residues K1209, K1212, and K1214. (B) PtdIns(3,4,5)P3 binding values of the control cationic patch of C1-Ten-SH2 by SPR analysis. WT and K1209Q/K1212Q/K12147Q (3KQ) mutant C1-Ten-SH2 were allowed to interact with POPC/POPS/PtdIns(3,4,5)P3 (77:20:3) vesicles.

NIHMS993699-supplement-1.docx (1.3MB, docx)

RESOURCES