Key resources table.
| Reagent type or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (H.sapiens) |
HeLa Flp-in | Tighe et al. (2008) | ||
| Recombinant DNA reagent |
pcDNA5-YFP-B56 α, β, γ1, γ3, δ and ε. |
This paper | B56 from pCEP-4xHA-B56 (Addgene 14532–14537) cloned into pcDNA5-LAP-BubR1WT (Nijenhuis et al., 2014), Not1-Apa1 sites. |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56α−(TKHG) | This paper | Site-directed mutagenesis of pcDNA5-YFP-B56α: E405T, P409K, V412H, A413G |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56α-(γ4) | This paper | See Figure 5—figure supplement 1 |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56γ-H187A | This paper | Site-directed mutagenesis of pcDNA5-YFP-B56γ |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56γ-ΔSgo1 | This paper | Site-directed mutagenesis of pcDNA5-YFP-B56γ: Y391F, L394S, M398Q. |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56γ-H187A-ΔSgo1 | This paper | Site-directed mutagenesis of pcDNA5-YFP-B56γ-H187A: Y391F, L394S, M398Q. |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56γ-(α4) | This paper | See Figure 5—figure supplement 1 |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56γ-(α4.1) | This paper | See Figure 6—figure supplement 1 |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56γ-(α4.2) | This paper | See Figure 6—figure supplement 1 |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56γ-(α4.3) | This paper | See Figure 6—figure supplement 1 |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56γ−(EPVA) | This paper | Site-directed mutagenesis of pcDNA5-YFP-B56γ: T631E, K635P, H638V, G639A. |
|
| Recombinant DNA reagent |
pcDNA5-YFP-B56-Ch1 | This paper | See Figure 5. | |
| Recombinant DNA reagent |
pcDNA5-YFP-B56-Ch2 | This paper | See Figure 5. | |
| Recombinant DNA reagent |
pcDNA5-YFP-B56-Ch3 | This paper | See Figure 5. | |
| Recombinant DNA reagent |
pcDNA5-YFP-B56-Ch4 | This paper | See Figure 5. | |
| Recombinant DNA reagent |
pcDNA5-YFP-B56-Ch4a | This paper | See Figure 5. | |
| Recombinant DNA reagent |
pcDNA5-YFP-B56-Ch4b | This paper | See Figure 5. | |
| Recombinant DNA reagent |
pcDNA5-YFP-B56-Ch4c | This paper | See Figure 5. | |
| Recombinant DNA reagent |
pcDNA5-YFP-B56-Ch4d | This paper | See Figure 5. | |
| Recombinant DNA reagent |
pcDNA5-vsv-CENP- B-Sgo2-mCherry |
This paper | PCR Sgo2 from pDONR-Sgo2 (gift T.J.Yen) into pcDNA5-vsv- CENP-B-Sgo1-mCherry |
|
| Recombinant DNA reagent |
pcDNA5-vsv-CENP-B- Sgo1-mCherry |
Meppelink et al. (2015) | ||
| Recombinant DNA reagent |
pHAGE-TO-dCas9- DARPIN-flag |
This paper | Progenitor plasmid: pHAGE-TO- dCas9-3xmCherry (Addgene 64108). 3xmCherry replaced with synthesised DARPIN-Flag (Brauchle et al., 2014). |
|
| Sequence-based reagent |
gRNA targeting a repetetive region on chromosome 7 |
Chen et al. (2016) | GCTCTTATGGTGAGAGTGT | |
| Sequence-based reagent |
B56 Knockin gRNAs | This paper | B56a: gatgtcgtcgtcgtcgccgccgg. B56g: gtcaacatctagacttcagcggg |
|
| Sequence-based reagent |
siRNAs | Foley et al. (2011) | B56α (PPP2R5A), 5’-UGAAUGAACUGGUUGAGUA-3’; B56β (PPP2R5B), 5’-GAACAAUGAGUAUAUCCUA-3’; B56γ (PPP2R5C), 5’-GGAAGAUGAACCAACGUUA-3’; B56δ (PPP2R5D), 5’-UGACUGAGCCGGUAAUUGU-3’; B56ε (PPP2R5E), 5’-GCACAGCUGGCAUAUUGUA-3’; |
|
| Sequence-based reagent |
siRNAs | Kitajima et al. (2006) | Sgo2, 5’-GCACUACCACUUUGAAUAA-3’; |
|
| Sequence-based reagent |
siRNAs | Dharmacon, J-015475–12 | Sgo1, 5’-GAUGACAGCUCCAGAAAUU-3’; |
|
| Sequence-based reagent |
siRNAs | Nijenhuis et al. (2014) | BubR1, 5’-AGAUCCUGGCUAACUGUUC-3’ |
|
| Sequence-based reagent |
siRNAs | Vleugel et al. (2013) | Knl1, 5’-GCAUGUAUCUCUUAAGGAA-3’; Bub1 5’-GAAUGUAAGCGUUCACGAA-3’; |
|
| Sequence-based reagent |
siRNAs | Dharmacon (D-001830) | Control (GAPDH), 5’-GUCAACGGAUUUGGUCGUA-3’ |
|
| Antibody | Mouse monoclonal anti-GFP (clone 4E12/8) |
Peter Parker, Francis Crick Institute |
1:1000 | |
| Antibody | Chicken polyclonal anti-GFP |
Abcam | Abcam: ab13970, RRID:AB_300798 |
1:5000 |
| Antibody | Mouse monoclonal anti-Sgo1 (clone 3C11) |
Abnova | Abnova: H001516480M01 |
1:1000 |
| Antibody | Rabbit polyclonal anti-Sgo2 |
Bethyl | Bethyl: A301-262A, RRID:AB_890650 |
1:1000 |
| Antibody | Mouse monoclonal anti-BubR1 (clone 8G1) |
EMD Millipore | EMD Millipore: 05–898, RRID:AB_417374 |
1:1000 |
| Antibody | Mouse monoclonal anti-VSV (clone P5D4) |
Sigma | Sigma: V5507, RRID:AB_261877 |
1:1000 |
| Antibody | Rabbit polyclonal anti-Knl1 |
Abcam | Abcam: ab70537, RRID:AB_1209410 |
1:1000 |
| Antibody | Rabbit polyclonal anti-Bub1 |
Bethyl | Bethy;l: A300-373A, RRID:AB_2065943 |
1:1000 |
| Antibody | Mouse monoclonal anti-FLAG (clone M2) |
Sigma | Sigma: F3165, RRID:AB_259529 |
1:10000 |
| Antibody | Guinea Pig polyclonal anti-Cenp-C |
MBL | MBL: PD030 | 1:5000 |
| Antibody | Rabbit polyclonal anti-pMELT-Knl1 (phospho-T943 and - T1155) |
Nijenhuis et al. (2014) | 1:1000 | |
| Antibody | Rabbit polyclonal anti-GFP |
Geert Kops, Hubrecht Institute |
1:5000 | |
| Antibody | Mouse monoclonal anti-B56γ (clone A-11) |
Santa Cruz Biotechnology |
Santa Cruz Biotechnology: sc-374379, RRID:AB_10988028 |
1:1000 |
| Antibody | Mouse monoclonal anti-B56α (clone 23) |
BD Biosciences | BD Biosciences: 610615, RRID:AB_397947 |
1:1000 |
| Antibody | Mouse monoclonal anti-B56δ (clone H-11) |
Santa Cruz Biotechnology |
Santa Cruz Biotechnology: sc-271363, RRID:AB_10611062 |
1:1000 |
| Antibody | Rabbit polyclonal anti-B56ε |
Aviva | Aviva: ARP56694-P50 |
1:1000 |
| Antibody | Mouse monoclonal anti-PPP2CA (clone 1D6) |
EMD Millipore | EMD Millipore: 05–421, RRID:AB_309726 |
1:5000 |
| Antibody | Rabbit polyclonal anti-PPP2R1A (clone 81G5) |
Cell Signaling Technology |
Cell Signaling Technology: 2041, RRID:AB_2168121 |
1:1000 |
| Antibody | Rabbit polyclonal anti-BubR1 |
Bethyl | Bethyl: A300-386A, RRID:AB_386097 |
1:1000 |
| Antibody | Rabbit polyclonal anti-Axin |
Cell Signaling Technology |
Cell Signaling Technology: C76H11, RRID:AB_2274550 |
1:1000 |
| Antibody | Rabbit polyclonal anti-GEF-H1 |
Abcam | Abcam: ab155785 | 1:1000 |
| Antibody | Rabbit polyclonal anti-Kif4A |
Bethyl | Bethyl: A301-074A, RRID:AB_2280904 |
1:1000 |
| Antibody | Rabbit polyclonal anti-Repoman |
Sigma | Sigma: HPA030049, RRID:AB_10600862 |
1:1000 |
| Antibody | Rabbit polyclonal anti-Actin |
Sigma | Sigma: A2066, RRID:AB_476693 |
1:5000 |
| Antibody | Mouse monoclonal anti-α-Tubulin (clone B-5-1-2) |
Sigma | Sigma: T5168, RRID:AB_477579 |
1:5000 |
| Antibody | Alexa-fluor488 anti-mouse |
ThermoFisher Scientific |
Invitrogen: A11029, RRID:AB_138404 |
1:1000 |
| Antibody | Alexa-fluor488 anti-rabbit |
ThermoFisher Scientific |
Invitrogen: A11034, RRID:AB_2576217 |
1:1000 |
| Antibody | Alexa-fluor488 anti-chicken |
ThermoFisher Scientific |
Invitrogen: A11039, RRID:AB_142924 |
1:1000 |
| Antibody | Alexa-fluor488 anti-guinea pig |
ThermoFisher Scientific |
Invitrogen: A11073, RRID:AB_142018 |
1:1000 |
| Antibody | Alexa-fluor568 anti-mouse |
ThermoFisher Scientific |
Invitrogen: A11031, RRID:AB_144696 |
1:1000 |
| Antibody | Alexa-fluor568 anti-rabbit |
ThermoFisher Scientific |
Invitrogen: A11036, RRID:AB_10563566 |
1:1000 |
| Antibody | Alexa-fluor647 anti-guinea pig |
ThermoFisher Scientific |
Invitrogen: A21450, RRID:AB_141882 |
1:1000 |
| Antibody | HRP-anti-mouse | Bio-Rad | Bio-Rad: 170–6516, RRID:AB_11125547 |
1:2000 |
| Antibody | HRP-anti-rabbit | Bio-Rad | Bio-Rad: 170–6515, RRID:AB_11125142 |
1:5000 |
| Chemical compound, drug |
AZ-3146 | Selleckchem | Selleckchem: S2731 | |
| Chemical compound, drug |
Calyculin A | LC labs | LC labs: C-3987 | |
| Chemical compound, drug |
4,6-diamidino-2- phenylindole (DAPI) |
Sigma | Roche: 10236276001 | |
| Chemical compound, drug |
Dulbecco's Modified Eagle Medium (DMEM) |
ThermoFisher Scientific |
Gibco: 41966029 | |
| Chemical compound, drug |
Doxycycline hyclate | Sigma | Sigma: D9891 | |
| Chemical compound, drug |
Fetal Bovine Serum | ThermoFisher Scientific |
Life Technologies: 10270106 |
|
| Chemical compound, drug |
GFP-Trap magnetic beads |
Chromotek | Chromotek: GTMA-20 | |
| Chemical compound, drug |
Hygromycin B | Santa Cruz Biotechnology |
Santa Cruz Biotechnology: sc-29067 |
|
| Chemical compound, drug |
Lipofectamine RNAiMax |
ThermoFisher Scientific |
Invitrogen: 13778150 | |
| Chemical compound, drug |
Nocodazole | EMD Millipore | EMD Millipore: 487928 | |
| Chemical compound, drug |
MG132 | Selleckcem | Selleckchem: S2619 | |
| Chemical compound, drug |
Opti-MEM reduced serum medium |
ThermoFisher Scientific |
Gibco: 31985–047 | |
| Chemical compound, drug |
penicillin/streptomycin | ThermoFisher Scientific |
Gibco: 15070–063 | |
| Chemical compound, drug |
RO-3306 | Tocris | Tocris: 4181 | |
| Chemical compound, drug |
Thymidine | Sigma | Sigma: T1895 | |
| Software, algorithm |
Kinetochore quantification macro |
Saurin et al. (2011) | Software, | |
| Algorithm | Multicolor Line plot quantification macro |
Kees Straatman (University of Leicester) with modification by Balaji Ramalingam (University of Dundee) |
||
| Software, algorithm |
Quantification of immunoblots |
Image Studio Lite (LI-COR Biosciences) |
||
| Software, algorithm |
Microscopy image processing |
Softworx software, GE Healthcare |
||
| Software, algorithm |
Microscopy image processing |
ImageJ, National Institutes of Health |