Skip to main content
. Author manuscript; available in PMC: 2019 Mar 7.
Published in final edited form as: Cancer Cell. 2018 Aug 13;34(2):331–345.e11. doi: 10.1016/j.ccell.2018.07.005

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Anti-DR5 (Human) Cell Signaling Technology Cat#3696
Anti-DR4 (Human) Cell Signaling Technology Cat#42533
Anti-FOLR1 Thermo Fisher Cat#PA5–24186
α-Tubulin Antibody Cell Signaling Technology Cat#2144
Cleaved Caspase-3 Antibody Cell Signaling Technology Cat#9661
Capase-3 Antibody Cell Signaling Technology Cat#9668
GAPDH Antibody Cell Signaling Technology Cat#5174
Caspase-8 Antibody Santa Cruz Biotechnology Cat#8CSP03
E-Cadherin Antibody Cell Signaling Technology Cat#14472
Anti-Rabbit-HRP antibody Cell Signaling Technology Cat#7074
Anti-Mouse-HRP antibody Cell Signaling Technology Cat#7076
Anti-DR5 (Mouse) antibody Abcam Cat#Ab8416
Cleaved PARP antibody Cell Signaling Technology Cat#9953
Commercial LK26 (anti-murine FOLR1) antibody Abcam Cat#Ab3361
Commercial MD5–1 (anti-Murine DR5) antibody Abcam Cat#ab171248
Anti-Human IgG1 HRP Life Technologies Ref#A10648
Anti-GFP antibody Santa-Cruz Biotechnology Cat#sc-9996
Mouse anti-human IgG1 Fc Thermo Fisher A10648
Bacterial and Virus Strains
E. coli Stellar™ F′, endA1, supE44, thi1, recA1, relA1, gyrA96, phoA, Φ80d lacZΔM15, Δ(lacZYA-argF) U169, Δ(mrr-hsdRMS-mcrBC), ΔmcrA, λ- Clontech
BL21 Competent E. coli NE Biolabs C2530H
DH5α Thermo Fisher 18258012
Biological Samples
PDX cell line: V584 Dr. Chip Landen, https://cancer.uvahealth.com/research/shared-resources/maps
PDX cell line: V565 Dr. Chip Landen, https://cancer.uvahealth.com/research/shared-resources/maps
PDX cell line: 111 Dr. Chip Landen, https://cancer.uvahealth.com/research/shared-resources/maps
PDX cell line: 135R Dr. Chip Landen, https://cancer.uvahealth.com/research/shared-resources/maps
Patient-derived xenografts (PDX) UVA MAPS core/Tumor bank https://cancer.uvahealth.com/research/shared-resources/maps
Chemicals, Peptides, and Recombinant Proteins
Recombinant Apo2L R&D systems Cat#375-TL
Recombinant HER2 R&D systems 1129-ER-050
Recombinant IgG4-Fc-DR5 (rDR5) This paper
Recombinant IgG4-Fc-FOLR1 (rFOLR1) This paper
Cisplatin Sigma NC0837572
EZ-Link Sulfo-NHS-SS-Biotin Thermo Fisher 21331
Critical Commercial Assays
Endpoint Chromogenic LAL endotoxin assay kit Lonza 50–648U
AlamarBlue Cell viability reagent Thermo Fisher DAL1100
MTT reagent Thermo Fisher
AST reagent Pointe Scientific 23-666-1221
EnzyChrom ALT Assay Kit Bioassay Systems EASTR-100
Deposited Data
doi:10.17632/tgnzd6m8y5.1 This Paper Shivange et al.,
Experimental Models: Cell Lines
Human: OVCAR-3 ATCC HTB-161
Human: OVCAR-4 ExPASy CVCL_1627
Human: OVCAR-5 ExPASy CVCL_1628
Human: CAVO3 ATCC HTB-75
Human: COV362 ExPASy CVCL_2420
Human: OV90 Kind gift from Dr. Chip Landen, UVA N/A
Human: OVSAHO Kind gift from Dr. Chip Landen, UVA N/A
Human: SKOV-3 ATCC HTB-77
Human: Colo-205 ATCC CCL-222
CHO-S cells Thermo Scientific R80007
Mouse: ID8 Kind gift from Dr. Chip Landen, UVA N/A
Mouse: MC38 Kind gift from Dr. Suzanne Ostrand-Rosenberg, UMBC N/A
PDX cell line: V584 Dr. Chip Landen, UVA UVA MAPS core/Tumor bank
PDX cell line: V565 Dr. Chip Landen, UVA UVA MAPS core/Tumor bank
PDX cell line: 111 Dr. Chip Landen, UVA UVA MAPS core/Tumor bank
PDX cell line: 135R Dr. Chip Landen, UVA UVA MAPS core/Tumor bank
K562 cells Kind gift from Dr. Golam Mohi, UVA N/A
HEK293 Kind gift from Dr. Sanchita Bhatnagar, UVA N/A
Human: Colo-205-GFP stable This Paper Generated in laboratory of novel biologics, UVA
Mouse: MC38-Luc stable This Paper Generated in laboratory of novel biologics, UVA
Mouse: ID8-Luc stable This Paper Generated in laboratory of novel biologics, UVA
HEK ATCC CRL-1533
Experimental Models: Organisms/Strains
Mouse: athymic Nude Foxn1nu/Foxn1+ Envigo RRID:MGI:5652489
Mouse: C56BL/6 Bhatnagar lab (UVA animal facility) NA
Mouse: CD1(Crl:CD1(ICR) Charles River RRID:IMSR_CRL:22
Mouse: C.B-17/IcrHsd-Prkdcscid UVA MAPS core, Envigo, Dublin, VA RRID:MGI:2160375
Oligonucleotides
Primer FOLR1 Forward: GTCGACCCTGGAGGAAGAAT This Paper N/A
Primer FOLR1 Reverse:
AGTCCAGTTCCAGCCCTTGT
This Paper N/A
Primer TRAIL-R2/DR5 Forward:
GATGGTCAAGGTCGGTGATT
This Paper N/A
Primer TRAIL-R2/DR5 Reverse:
TGGACTTCCATTTCCTGCTC
This Paper N/A
Primer GALNT3 Reverse:
ACAGAGGTTCTAGCCAACCAT
This Paper N/A
Primer FUT3 Forward:
CTGTCCCGCTGTTCAGAGATG
This Paper N/A
Primer FUT3 Reverse:
AGGCGTGACTTAGGGTTGGA
This Paper N/A
Recombinant DNA
Full Length Lexatumumab IgG and scFv This Paper GeneArt, Thermo Fisher
Full Length Farletuzumab IgG and scFv This Paper GeneArt, Thermo Fisher
Full Length AMG-655 IgG and scFv This Paper GeneArt, Thermo Fisher
Full Length LK26 IgG and scFv This Paper GeneArt, Thermo Fisher
Full Length MD5–1 IgG and scFv This Paper GeneArt, Thermo Fisher
Full Length Recombinant DNA, huFOLR1-IgG4-Fc This Paper GeneArt, Thermo Fisher
Full Length Recombinant DNA, huDR5-IgG4-Fc This Paper GeneArt, Thermo Fisher
Full Length Idarucizumab IgG and scFv GeneArt, Thermo Fisher GeneArt, Thermo Fisher
pCDNA3.1+ Thermo Fisher V79020
pET-28a Addgene 69864–3
pTT5 (Durocher and Butler, 2009) Addgene (52326)
Software and Algorithms
Vector NTI Thermo scientific N/A
GraphPad Prism GraphPad Software www.graphpad.com
FlowJo FlowJo, LLC www.flowjo.com
FCS Express De Novo Software www.denovosoftware.com
Other
PowerUp SYBR Green Master mix Thermo Fisher A25742
Superscript II Invitrogen 18064014
Halt protease inhibitor Thermo Fisher 78430
CHO CD efficient Feed B Thermo Fisher A1024001
Tryptone Feed Thermo Fisher BP9726–2
PEI transfection reagent Thermo Fisher BMS1003A
Matrigel Corning 354234
Infusion Takara BioScience 638989
IRDye 800CW LI-COR Cat#929–70020
TMB Substrate Reagent Set BD OptEIA Cat # 555214
7 Aminoactinomycin-D (7-AAD) Thermo Fisher A1310
CHO free style Media Thermo Fisher 12651014
HiTrap MabSelect Sure column GE 11003493
Protein-A resin Thermo Fisher P153142
HisPur Ni-NTA resin Thermo Fisher 88221
HiPure Plasmid Maxiprep kit Invitrogen K21007