Table 2.

Gene therapy tests and strategy used for HGPS treatment on tissue culture and mouse models.

Strategy	Reference	Name and Target Sequence 5′->3′	Target Transcript
Silencing of transcript variant 7, binds specifically to transcript coding for progerin	[144]	shRNA3 GGCTCAGGAGCCCAGAGCCCC	Variant 7
	[145]
	[146]
Blocking the activated cryptic splice site in exon 11, binds directly to the sequence of cryptic splice site	[104]	Ex11 CTCAGGAGCCCAGGTGGGTGGACCC	Mutated pre-mRNA
	[117]
	[124]
	[125]
	[132]
Blocking the activated cryptic splice site in exon 11, binds upstream of this site	[124]	ASO 365 CTGTGCGGGACCTGCGGGCA	Mutated pre-mRNA
Binding to exon 10 splice site and shift splicing towards lamin C	[104]	Ex10 CCATCACCACCACGTGAGTGGTAGC	Pre-mRNA, mutated pre-mRNA
	[117]
	[132]