Table 2.
Description of the 8 INDELs between traditional and variant TGEV using TGEV/USA/Z/1986 as reference.
| No. | Nucleotide (nt) position | Number of nt deleted | Nt deleted | Correponding amino acid (aa) variation |
|---|---|---|---|---|
| 1 | 3259–3264 | 6 | ATATCA | Two aa deletion in the NSP3 protein |
| 2 | 3354–3356 | 3 | GTA | Single aa deletion in the NSP3 protein |
| 3 | 4249–4251 | 3 | AAA | Single aa deletion in the NSP3 protein |
| 4 | 24727–24729 | 3 | ATC | Deletion in the non-coding region between S and ORF3a genes |
| 5 | 24750–24765 | 16 | TTTCTGCTAGAGAATT | Deletion in the non-coding region between S and ORF3a gene |
| 6 | 25020–25048 | 29 | TCAATAGTCATATAGTTGTTTAATATCAT | Single deletion in the ORF3a protein |
| 7 | 25127–25130 | 4 | CATG | Deletion in the non-coding region between ORF3a and ORF3b genes |
| 8 | 26185–26187 | 3 | TCC | Single aa deletion in the M protein |