REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
anti-total Tau clone 7 (IF 1:100, WB 1:1000)	EMD Millipore	MAB2239 RRID:AB_1587549
anti-pS202/T205 Tau (IF 1:50, WB 1:500)	Peter Davies	CP13 RRID:AB_2314223
anti-pS396/S404 Tau (IF 1:50, WB 1:500)	Peter Davies	PHF1 RRID:AB_2315150
anti-pThr231 conformational (IF 1:50)	Peter Davies	TG3 RRID:AB_2716726
anti-MAP2 (IF 1:1000)	Abcam	ab5392 RRID:AB_2138153
anti-neurofilament 131/132 (IF 1:5000)	Covance	SMI31 RRID:AB_2314901
anti-Actin clone C4 (WB 1:50,000)	EMD Millipore	MAB1501 RRID:AB_2223041
anti-APLP2 (WB 1:1000)	Calbiochem/Millipore	171617 RRID:AB_565357
anti-APP A4 clone 22C11 (WB 1:1000)	EMD Millipore	MAB348 RRID:AB_94882
anti-APP C-Terminal (WB 1:500)	EMD Millipore	171610 RRID:AB_211444
anti-total Tau (WB 1:1000)	Sigma	T6402 RRID:AB_261728
anti-histone 3 clone (WB 1:1000)	Upstate/Millipore	06-755 RRID:AB_11211742
anti-LC3b (WB 1:1000)	Novus biologicals	NB600-1384 RRID:AB_669581
anti-ubiquitin (WB 1:250)	EMD Millipore	MAB1510 RRID:AB_2180556
anti-Phospho-4E-BP1 (Thr37/46) (WB 1:1000)	Cell Signaling	Antibody #9459 RRID:AB_330985
anti-p70 S6 Kinase Antibody (WB 1:1000)	Cell Signaling	Antibody #9202 RRID:AB_331676
anti-4E-BP1 Antibody (WB 1:1000)	Cell Signaling	Antibody #9452 RRID:AB_331692
anti-Phospho-p70 S6 Kinase (Thr389) (WB 1:1000)	Cell Signaling	108D2, Antibody RRID:AB_2269803
Anti-PSMC2 (D5T1T)) (WB 1:1000)	Cell Signaling	#14395 RRID:AB_2752224
anti-PSMB5 (WB 1:1000)	Enzo Lifesciences	Cat# BML-PW8895 RRID: AB_10540901
anti-GAPDH (WB 1:1000)	Life Technologies	AM4300 RRID: AB_2536381
anti-Nestin Clone 25/NESTIN (RUO) (1:500)	BD	611658 RRID:AB_399176
anti-S100b (1:500)	Proteintech	15146-1-AP RRID:AB_2254244
anti-Vamp2 (aka synaptobrevin 2) (1:1000)	synaptic systems	104 211 RRID:AB_887811
anti- Syntaxin 1 (1:5000)	Gift from the Thomas Sudhof lab	polyclonal #I379
anti-Synaptotagmin (1:2000	Gift from the Thomas Sudhof lab	polyclonal #W855
Tra-181-647	BD	560124 RRID:AB_1645449
CD184-APC (FC 1:10)	BD	555976 RRID:AB_398616
CD44-PE (FC 1:10)	BD	555479 RRID:AB_395871
CD24-PECy7 (FC 1:40)	BD	561646 RRID:AB_10892826
CD271-PE	BD	557196 RRID:AB_396599
Chemicals, Peptides, and Recombinant Proteins
T0901317	Sigma	T2320
GW501516	Enzo life sciences	89150-762
Rosiglitazone	Sigma	R2408
Atorvastatin calcium salt	Sigma	PZ001
Simvastatin	Sigma	S6196
Rosuvastatin	Sigma	SML1264
Fluvastatin	Sigma	SML0038
Mevastatin	Tocris	1526
Lovastatin	Sigma	PHR1285
Mevalonolactone (Mevalonic Acid)	Sigma	M4777
(R)-Mevalonic acid 5-pyrophosphoate tetralithium salt	Sigma	77631
Mevalonic acid 5-phosphate thrilithium salt hydrate	Sigma	79849
Methyl-β-cyclodextrin	Sigma	C4555
YM-53601	Cayman Chemicals	18113
AY 9944 dihydrochloride	Tocris	1639
FTI-227 trifluoroacetate salt	Sigma	F9803
GGTI-298 trifluoracetate salt hydrate	Sigma	G5169
Fatostatin hydrobromide	Sigma	F8932
24(S)-hydroxycholesterol	Cayman Chemicals	10009931
chloroquine diphosphate salt	Sigma	C6628
MG-132 (InSolution)	Calbiochem	37391
Cholestane	Sigma-Aldrich	C8003
N-Methyl-N-(trimethylsilyl)trifluoroacetamide (MSTFA)	ThermoFisher	TS48910
dry pyridine	Sigma-Aldrich	270970
sodium hydroxide solution 10M (BioUltra)	Sigma Aldrich	72068
Ri, Y-27632 dihydrochloride	Abcam	ab120129
SB431542	Stemgent	4-0010
Noggin	R&D	3344-NG
Proteasome activity probe 1	Berkers et al., 2007, de Jong et al., 2012	N/A
SCR7	Excess Bioscience	M60082-2
L-755,507	Sigma	SML1362
K-604	Sigma	SML1837
Critical Commercial Assays
Phospho(Thr231)/Total Tau Kit	MSD	K15121D-3
V-PLEX Ab Peptide Panel 1 (6E10) Kit (25 Plate)	MSD	K15200E-4
24(S)-Hydroxycholesterol ELISA kit	Enzo	ADI-900-210-0001
CellTiter-Glo® Luminescent Cell Viability Assay	Promega	G7571
CellTiter 96® AQueous One Solution Cell Proliferation Assay	Promega	G3580
Pierce LDH Cytotoxicity Assay Kit	Thermo Fisher Scientific	88954
Amplex Red Cholesterol Assay Kit	ThermoFisher Scientific	A12216
Lipidyzer	Sciex	N/A
Experimental Models: Cell Lines
CV (NPC)	Gore et al., 2011	RRID:CVCL_1N86
151 (CV WT) (iPSC, NPC)	Fong et al., 2018	RRID: CVCL_UI49
IB6 (APPnull in CV background) (iPSC, NPC)	Fong et al., 2018	RRID:CVCL_UI22
B10 (CV Wt) (iPSC, NPC)	This Paper	RRID:CVCL_VR50
B11 (CV Wt) (iPSC, NPC)	This Paper	RRID:CVCL_VR51
3d9 (CV APP E693A) (iPSC, NPC)	This Paper	RRID:CVCL_VR53
2b2 (CV APP E693A) (iPSC, NPC)	This Paper	RRID:CVCL_VR52
D12 (CV APP E693A+F691A) (iPSC, NPC)	This Paper	RRID:CVCL_VR54
APPdp1.2 (iPSC, NPC)	Israel et al., 2012	RRID:CVCL_EJ97
APPdp 1.6 (iPSC, NPC)	Israel et al., 2012	RRID:CVCL_EJ96
APPdp 2.1 (iPSC, NPC)	Israel et al., 2012	RRID:CVCL_EJ99
APP 1KO (APPnull in APPdp1.2 background) (iPSC, NPC)	This Paper	RRID: CVCL_UI23
NDC1 (M) NPC	Israel et al., 2012, Young et al., 2015	RRID:CVCL_EJ84
NDC2 (M) NPC	Israel et al., 2012, Young et al., 2015	RRID:CVCL_EJ87
NDC3 (M) NPC	Young et al., 2015	RRID: CVCL_UB88
NDC4 (M) NPC	Young et al., 2015	RRID: CVCL_UB89
NDC5 (M) NPC	Young et al., 2015	RRID: CVCL_UB90
SAD1 (F) NPC	Israel et al., 2012, Young et al., 2015	RRID: CVCL_EJ90
SAD2 (M) NPC	Israel et al., 2012, Young et al., 2015	RRID: CVCL_EJ93
SAD3 (M) NPC	Young et. al. 2015	RRID: CVCL_UB91
SAD4 (F) NPC	Young et. al. 2015	RRID: CVCL_UB92
SAD5 (F) NPC	Young et. al. 2015	RRID: CVCL_UB93
SAD6 (M) NPC	Young et. al. 2015	RRID: CVCL_UB94
SAD7 (M) NPC	Young et. al. 2015	RRID: CVCL_UB95
Experimental Models: Organisms/Strains
C57BL/6J Mice	Jackson Laboratory	000664
Oligonucleotides
Repair Oligos used to make CRISPR mutant lines See Table S6	This Paper	N/A
Primers for amplification of APP Cholesterol Binding region See Table S6	This Paper	N/A
APP Cholesterol binding region genomic DNA Sequencing Primer See Table S6	This Paper	N/A
qPCR Primers See Table S6	This Paper	N/A
Recombinant DNA
G7A: TOPO guide RNA plasmid for Generating cholesterol-mutant lines with target sequence: 5′GTGTTCTTTGCAGAAGATGTGGG3′	This Paper	N/A
Guide RNA plasmid for generating APPnull line in APPdp-patient background with target sequence: 5′GGAGATCTCTGAAGTGAAGATGG3′	This Paper	N/A
CMV::Cas9-2A-eGFP	Sigma-Aldrich	CAS9GFPP-1EA
CYP46A1-pDESTlentiFGA1.0.	This Paper	N/A
GFP-only plasmid-pDESTlentiFGA1.0. (pSyn(pr)EGFPLL3.7)	This Paper	N/A