KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Critical Commercial Assays | ||
| KAPA mRNA Hyper Prep kit | Roche Sequencing | Cat# KK8581 |
| Deposited Data | ||
| Duck genome: Anas platyrhynchos | NCBI | GCF_000355885.1 |
| Chicken genome: Gallus gallus | NCBI | GCF_000002315.5 |
| Transcriptome of bird trigeminal ganglia | This paper | GEO: GSE125754 |
| Experimental Models: Organisms/Strains | ||
| American black duck (Anas rubripes) Harlequin duck (Histrionicus histrionicus) | USGS Patuxent Wildlife Research Center | N/A |
| Lesser Scaup (Aythya affinis) | ||
| Hooded merganser (Lophodytes cucullatus) | Livingston Ripley Waterfowl Conservancy | N/A |
| Ruddy duck (Oxyura jamaicensis) | ||
| Wood duck (Aix sponsa) | USGS Patuxent Wildlife Research Center or Livingston Ripley Waterfowl Conservancy | N/A |
| Pekin duck (Anas platyrhynchos domesticus) | Metzer Farms | N/A |
| Domestic chicken (Gallus domesticus) | ||
| Oligonucleotides | ||
| Piezo2 in situ RNA probe primer Fwd GACAGTATCTCCAGCTGCTAC | (Schneider et al., 2014) | N/A |
| Piezo2 in situ RNA probe primer Rev TTATGGACCATCAGCCCTCCCA | (Schneider et al., 2014) | N/A |
| Software and Algorithms | ||
| GraphPad Prism 7 | GraphPad | RRID:SCR_002798 |
| ImageJ | NIH | RRID:SCR_003070 |
| pClamp | Molecular Devices | RRID:SCR_011323 |
| MetaFluor | Molecular Devices | RRID:SCR_014294 |
| Igor Pro 6.3 | Wavemetrics | RRID:SCR_000325 |
| TaroTools | Dr. Taro Ishikawa, Jikei University | N/A |
| Trimmomatic | (Bolger et al., 2014) | RRID:SCR_011848 |
| STAR | (Dobin et al., 2013) | RRID:SCR_015899 |
| featureCounts | (Liao et al., 2014) | RRID:SCR_012919 |
| R | N/A | RRID:SCR_001905 |
| edgeR (package for R) | (Robinson et al., 2010) | RRID:SCR_012802 |
| Hmisc (package for R) | N/A | N/A |