REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit anti-AFF1 Antibody, Affinity Purified	Bethyl Laboratories	Bethyl Cat# A302-344A, RRID:AB_1850255
Rabbit anti-ELL2 Antibody, Affinity Purified	Bethyl Laboratories	Bethyl Cat# A302-505A, RRID:AB_1966087
Pol II Rpb1 NTD (D8L4Y) Rabbit mAb	Cell Signaling Technology	Cell Signaling Technology Cat# 14958, RRID:AB_2687876
BRD2 (D89B4) Rabbit mAb	Cell Signaling Technology	Cell Signaling Technology Cat# 5848, RRID: AB_10835146
BRD4 (E2A7X) Rabbit mAb	Cell Signaling Technology	Cell Signaling Technology Cat# 13440, RRID: AB_2687578
MED26 (D4B1X) Rabbit mAb	Cell Cell Signaling Technology	Cell Signaling Technology Cat# 14950
c-Myc (D3N8F) Rabbit mAb	Cell Signaling Technology	Cell Signaling Technology Cat# 13987, RRID:AB_2631168
Tubulin beta antibody	DSHB	DSHB Cat# E7, RRID:AB_528499
AFF4 Antibody	Proteintech	Proteintech Group Cat# 14662–1-AP, RRID:AB_2242609
Cyclin T1 Antibody (H-245)	Santa Cruz	Santa Cruz Biotechnology Cat# sc-10750, RRID:AB_2073888
HSP 90α/β Antibody	Santa Cruz	Santa Cruz Biotechnology Cat# sc-7947, RRID:AB_2121235
CDK9 Antibody (C-20)	Santa Cruz	Santa Cruz Biotechnology Cat# sc-484, RRID:AB_2275986
Anti-RNA polymerase II subunit B1 (phospho CTD Ser2) Antibody, clone 3E10	Active Motif	Active Motif Cat# 61083, RRID:AB_2687450
FLAG-synthetic antibody	Sigma-Aldrich	Sigma-Aldrich Cat# F3165, RRID:AB_259529
ANTI-FLAG M2 Affinity Gel	Sigma-Aldrich	Sigma-Aldrich Cat# A2220, RRID:AB_10063035
Anti-SPT5 Antibody, clone 6F1	Millipore	Millipore Cat# MABE1803
Rabbit anti-AFF1 serum	(Lin et al., 2010)	N/A
Rabbit anti-ELL2 serum	(Lin et al., 2010)	N/A
Rabbit anti-AFF4 serum	(Lin et al., 2010)	N/A
Rabbit anti-Drosophila Rpb1 antibody	(Lin et al., 2010)	N/A
Bacterial and Virus Strains
Biological Samples
Chemicals, Peptides, and Recombinant Proteins
Flavopiridol	Cayman	Cat# 10009197
4-Thiouridine	Sigma-Aldrich	Cat# T4509
Screening compounds	ChemDiv, ChemBridge and Enamine	N/A
EZ-Link™ HPDP-Biotin	Thermo	Cat# 21341
KL-1	This study	N/A
KL-2	This study	N/A
Biotin-AFF4 (32–67) peptides	VCPBIO	N/A
Biotin-AFF4 mutant peptides	VCPBIO	N/A
Glycogen	Sigma-Aldrich	Cat# 10901393001
GST-CCNT1 (1–300)	This study	N/A
α-Amanitin	Santa Cruz	CAS 23109–05-9
Biotin-11-ATP	Perkin Elmer	Cat# NEL544001EA
Biotin-11-CTP	Perkin Elmer	Cat# NEL542001EA
Biotin-11-GTP	Perkin Elmer	Cat# NEL545001EA
Biotin-11-UTP	Perkin Elmer	Cat# NEL543001EA
RNA 5’ Pyrophosphohydrolase (RppH)	NEB	Cat# M0356S
2% Agarose, PippinHT, 100–600 bp.10/pkg.	Sage science	Cat# HTC2010
BD Matrigel Matrix	BD Biosciences	Cat# 354234
Critical Commercial Assays
TruSeq® Stranded Total RNA LT - (with Ribo-ZeroTM Human/Mouse/ Rat) - Set A	Illumina	RS-123–2201
TruSeq® Stranded Total RNA LT - (with Ribo-ZeroTM TM Human/ Mouse/Rat) - Set B	Illumina	RS-123–2202
High-Throughput Library Preparation Kit Standard PCR Amp Module - 96 rxn	KAPA Biosystems	KK8234
RNeasy Mini Kit	Qiagen	Cat# 74104
Vi-CELL Reagent Quad Pak	Beckman Coulter	Cat# 383198
AlphaScreen GST Detection Kit, 500 assay points	Perkin Elmer	Cat# 6760603C
AlphaScreen Streptavidin Donor beads	Perkin Elmer	Cat# 6760002S
RNeasy MinElute Cleanup Kit	Qiagen	Cat# 74204
Glutathione Superflow Agarose	Thermo	Cat# 25236
Dynabeads® MyOne™ Streptavidin C1	Thermo	Cat# 65001
Streptavidin M280 beads	Invitrogen	Cat# 11206D
Dynabeads Protein G	Invitrogen	Cat# 10003D
Phase Lock Gel Heavy	VWR	Cat# 10847–802
Trizol Reagent	Invitrogen	Cat# 15596–018
Crystal violet solution	Sigma-Aldrich	Cat# HT90132–1L
Dead Cell Apoptosis Kit with Annexin V Alexa Fluor® 488 & Propidium Iodide (PI)	Thermo	Cat# V13245
CellTiter-Glo® 2.0 Assay	Promega	Cat# G9242
Deposited Data
Raw and analyzed data	This paper	GEO: GSE112608
Human reference genome GRCh37/hg19	Genome Reference Consortium	https://www.ncbi.nlm.nih.gov/assembly/GCF_000001405.13/
Drosophila reference genome BDGP Release 5/dm3	Genome Reference Consortium	http://www.fruitfly.org/sequence/release3genomic.shtml
Experimental Models: Cell Lines
HCT-116, human, male	ATCC	ATCC Cat# CCL-247, RRID:CVCL_0291
J-Lat 6.3 clone (Jurkat cells), human, male	NIH AIDS Program	NIH-ARP Cat# 9846-446, RRID:CVCL_8280
HEK-293T, human, male	ATCC	ATCC Cat# CRL-3216, RRID:CVCL_0063
HEK293T Flag-AFF1	(Lin et al., 2010)	N/A
HEK293T Flag-AFF4	(Lin et al., 2010)	N/A
NCI-H2171 [H2171] (ATCC® CRL-5929™), human, male	ATCC	ATCC Cat# CRL-5929, RRID:CVCL_1536
SW 1271 [SW1271] (ATCC® CRL-2177™), human, male	ATCC	ATCC Cat# CRL-2177, RRID:CVCL_1716
FAST Pol II Mutant E1126G HEK293 cells, human, female	(Fong et al., 2014)	N/A
WT Pol II Mutant HEK293 cells, human, female	(Fong et al., 2014)	N/A
Slow Pol II Mutant R749H HEK293 cells, human, female	(Fong et al., 2014)	N/A
MDA231-LM2, human, female	(Wang et al., 2017)	N/A
S2 cells, Drosophila, male	Invitrogen	Cat# R690–07
Experimental Models: Organisms/Strains
athymic nude mice, nu/nu	Envigo	Hsd:Athymic NudeFoxn1nu
Oligonucleotides
Recombinant DNA
shRNA targeting sequence: AFF1 #1 GCCTCAAGTGAAGTTTGACAA	Sigma-Aldrich	Clone ID: TRCN0000021975
shRNA targeting sequence: AFF1 #2 TAGGTTGGGAAAGCCGAAATA	Sigma-Aldrich	Clone ID: TRCN0000330908
shRNA targeting sequence: AFF4 #1 GCACGACCGTGAGTCATATAA	Sigma-Aldrich	Clone ID: TRCN0000426769
shRNA targeting sequence: AFF4 #2 GCACCAGTCTAAATCTATGTT	Sigma-Aldrich	Clone ID: TRCN0000015825
shRNA targeting sequence: ELL2 #1 AACGCCAGAATTATAAGGATG	This paper	N/A
shRNA targeting sequence: ELL2 #2 AAATGATCCCCTCAATGAAGT	This paper	N/A
Lenti-sh1368 knockdown c-myc shRNA targeting sequence: GACGAGAACAGTTGAAACA	Addgene	Addgene plasmid # 29435
pGEX-2TK cyclin T1 (1–300)	Addgene	Addgene plasmid # P432
Software and Algorithms
TopHat 2.1.0	(Kim et al., 2013)	https://ccb.jhu.edu/software/tophat/index.shtml
MACS 1.4.2	(Zhang et al., 2008)	http://liulab.dfci.harvard.edu/MACS/
EdgeR 3.12.0	(Robinson et al., 2010)	http://bioconductor.statistik.tu-dortmund.de/packages/2.11/bioc/html/edgeR.html
Bowtie version 1.1.2	(Langmead et al., 2009)	http://bowtiebio.sourceforge.net/index.shtml
Trimmomatic 0.33	(Bolger et al., 2014)	http://www.usadellab.org/cms/index.php?page=trimmomatic
Cutadapt 1.14	(Martin, 2011)	https://cutadapt.readthedocs.io/en/stable/guide.html
Bedtools 2.17	(Quinlan and Hall, 2010)	https://launchpad.net/ubuntu/+source/bedtools/2.17.0-1
Metascape	(Tripathi et al., 2015)	http://metascape.org/gp/index.html
R 3.2.1		https://www.rproject.org/
ZINC database	(Irwin et al., 2012)	http://zinc.docking.org
Small-Molecule Drug Discovery Suite 2017–2	Schrödinger	https://www.schrodinger.com/suites/small-molecule-drugdiscovery-suite
Prism 7	GraphPad Software	https://www.graphpad.com
FlowJo	FlowJo, LLC	https://www.flowjo.com
Dassault Systèmes BIOVIA	Dassault Systèmes	https://www.3ds.com/productsservices/biovia/
Other