Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2019 Mar 21;20:151. doi: 10.1186/s12859-019-2711-y

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© The Author(s) 2019

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

PMC Copyright notice

Fig. 5 — Minimum Free Energy (MFE) structures of MIATsub92 local structures of Human and Pan. The duplication of a TTTGAACTTGGCTAACACAGG sequence in the human lineage might have driven the evolution of the structure towards a more stable structure. Prevailing red regions exhibit well-defined structures with probabilities close to 1 for paired and unpaired bases. Duplicated regions are labeled with horizontal and vertical lines, and G/A nucleotide substitution is marked with an arrow. Bonobo has the same sequence as the chimpanzee