Table 2. Primer sequences, for the three target genes (Hsp70, β-actin and 18S) in H. scabra, and technical details: Number of amplicon base pairs (bp), melting temperature (Tm) and total content of Gs and Cs (GC).
| Primer pair | Sequence (5'->3') | Amplicon (bp) | Tm (°C) | GC (%) |
|---|---|---|---|---|
| Hsp70 (forward) | ATCCCGTTACCCATGCTGTG | 145 | 60.11 | 55.00 |
| Hsp70 (reverse) | AGCCCATAGGCAATAGCAGC | 60.25 | 55.00 | |
| β-actin (forward) | ACTCTGCTACGTCGCTCTTG | 143 | 58.7 | 55.0 |
| β-actin (reverse) | GGAAGAGTGTCTCTGGGCAA | 58.6 | 55.0 | |
| 18S (forward) | GCTACTACCGATCGAATGGC | 161 | 57.2 | 55.0 |
| 18S (reverse) | GATCCATCTGCAGGTTCACC | 57.5 | 55.0 |