KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Bacterial and Virus Strains | ||
| Pseudomonas aeruginosa | This paper: Isolated from samples 184 (mock community), 185 and 187 | N/A |
| Staphylococcus aureus | This paper: Isolated from samples 183, 188 (mock community) and 189 | N/A |
| Neisseria sp. unclassified | This paper: Isolated from sample 188 | N/A |
| Achromobacter xylosoxidans | This paper: Isolated from samples 183 and 189 (mock community) | N/A |
| Streptococcus salivarius | This paper: Isolated from sample 190 | N/A |
| Stenotrophomonas maltophila | This paper: Isolated from sample 188 | N/A |
| Rothia mucilaginosa | This paper: Isolated from samples 188 (mock community) | N/A |
| Rothia dentocariosa | This paper: Isolated from samples 183 and 190 | N/A |
| Rothia aeria | This paper: Isolated from sample 188 | N/A |
| Biological Samples | ||
| Sputum sample 183 | This paper | N/A |
| Sputum sample 184 | This paper | N/A |
| Sputum sample 185 | This paper | N/A |
| Sputum sample 186 | This paper | N/A |
| Sputum sample 187 | This paper | N/A |
| Sputum sample 188 | This paper | N/A |
| Sputum sample 189 | This paper | N/A |
| Sputum sample 190 | This paper | N/A |
| Sputum sample 205 | This paper | N/A |
| Sputum sample 309 | This paper | N/A |
| Sputum sample 312 | This paper | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Phosphate Buffered Saline (PBS) | Sigma | D8537–500ML |
| Tris-EDTA, pH 8.0 | Fisher Scientific | AM9849 |
| 0.1mm silica:zirconia beads | Fisher Scientific | 11079101z |
| 1mm silica:zirconia beads | Fisher Scientific | NC9847287 |
| Tungsten-carbide beads | QIAGEN | 69997 |
| Lysozyme | Sigma | L6876 |
| Lysostaphin | Ambi | LSPN |
| Proteinase K | Fisher Scientific | 25-530-049 |
| 10% Sodium Dodecyl Sulfate | Fisher Scientific | 15-553-027 |
| 5M Sodium chloride | Fisher Scientific | AM9759 |
| Pheno:Chloroform:lsoamyl alcohol | Sigma | P2069–400ML |
| 3M Ammonium Acetate | Fisher Scientific | FERR1181 |
| 200 proof Ethanol | Fisher Scientific | 07-678-003 |
| TrypZean | Sigma | T3449 |
| Tween-20 | Sigma | P9416 |
| Molecular grade water | WVR | M46000 |
| 1M Tris-HCI, pH8.0 | Fisher Scientific | 15-568-025 |
| 1M Magnesium Chloride | Fisher Scientific | AM9530G |
| Benzonase | Sigma | E-1014 |
| 0.5M EDTA | Fisher Scientific | 15-575-020 |
| Propidium monoazide | VWR | 89139–068 |
| PowerUp SYBR Green Master mix | Applied Biosystems | A25742 |
| 5 Primer Hot Master Mix | VWR | 2200410 |
| Sputolysin (DTT) | Fisher Scientific | 56-000-010mL |
| Critical Commercial Assays | ||
| EZ-10 Spin Column Bacterial Genomic DNA Mini-prep Kit | Biobasic | BS423 |
| Deposited Data | ||
| Metagenomic sequencing and 16S amplicon sequencing data | This paper | NCBI Bioproject: PRJNA516442 |
| Oligonucleotides | ||
| GGGCAACGTGCTGGTCTG | Handschur et al., 2009 | Human-betaG-F |
| AGGCAGCCTGCACTGGT | Handschur et al., 2009 | Human-betaG-R |
| TCCTACGGGAGGCAGCAGT | Nadkarni et al., 2002 | Universal16S_F |
| GGACTACCAGGGTATCTAATCCTGTT | Nadkarni et al., 2002 | Universal16S_R |
| Software and Algorithms | ||
| Bio-Rad CFX Manager 3.1 | Biorad | 1845000 |
| SeqUniq |
https://github.com/standage/sequniq |
Version 0.1 |
| KneadData | https://bitbucket.org/biobakery/kneaddata/wiki/Home | Version 0.6.1 |
| Trimmomatic | Bolger et al., 2014 | RRID:SCR_011848; Version 0.33 |
| BMTagger | https://bioconda.github.io/recipes/bmtagger/README.html; Human Microbiom Project | RRID:SCR_014619; Version 3.101 |
| MetaPhlAn2 | Thompson et al., 2017; Truong et al., 2015 | RRID:SCR_004915; Version 2.2.0 |
| DADA2 | Wang et al., 2007 | Version 1.6.0 |
| RDP Bayesian classifier | Wang et al., 2007 | Implemented through DADA2 (Version 1.6.0) |
| R | R Core Team, 2017 | RRID:SCR_001905; Version 3.4.2 |
| ggplot2 | Wickham, 2009 | RRID:SCR_014601; Version 2.2.1 |
| Vegan | Oksanen et al., 2017 | RRID:SCR_011950; Version 2.4.4 |
| Ape | Paradis et al., 2004 | Version 5.0 |
| ggtree | Yu et al., 2016 | Version 1.10.0 |
| Megahit | Li et al., 2015 | Version 1.1.2 |
| Bowtie2 | Langmead and Salzberg, 2012 | RRID:SCR_016368; Version 2.2.6 |
| Prodigal | Hyatt et al., 2010 | RRID:SCR_011936; Version 2.6.3 |
| Centrifuge | Kim et al., 2016 | RRID:SCR_016665; Version 1.0.3-beta |
| Anvi’o | Eren et al., 2015 | Version 4 |
| Inkscape | https://inkscape.org | RRID:SCR_014479; Version 0.92.3 |