Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | PTPRK | ENSEMBL: ENST00000368213.9 | ||
| Cell line (H. sapiens) | MCF10A | ATCC | CRL-10317 | |
| Cell line (H. sapiens) | HEK293T | D Ron | N/A | |
| Cell line (H. sapiens) | HEK293 | Sigma (ECACC) | 85120602-1VL | |
| Cell line (H. sapiens) | Hs27 Fibroblasts | Sigma (ECACC) | 94041901-1VL | |
| Cell line (H. sapiens) | MCF10A PTPRK KO A4 | This study | CRISPR/Cas9 and clonal selection |
|
| Cell line (H. sapiens) | MCF10A PTPRK KO E3 | This study | CRISPR/Cas9 and clonal selection |
|
| Cell line (H. sapiens) | MCF10A PTPRK KO H1 | This study | CRISPR/Cas9 and clonal selection |
|
| Cell line (H. sapiens) | MCF10A PTPRK KO pooled | This study | ||
| Transfected construct (H. sapiens) |
MCF10A PTPRK KO pooled.tGFP | This study | Lentivirally transduced stable cell line |
|
| Transfected construct (H. sapiens) |
MCF10A PTPRK KO pooled.tGFP.P2A.PTPRK |
This study | Lentivirally transduced stable cell line |
|
| Transfected construct (H. sapiens) |
MCF10A PTPRK KO pooled.tGFP.P2A.PTPRK.C1089S | This study | Lentivirally transduced stable cell line |
|
| Transfected construct (H. sapiens) |
MCF10A.tGFP | This study | Lentivirally transduced stable cell line |
|
| Transfected construct (H. sapiens) |
MCF10A.tGFP.P2A.PTPRK.ECD-TMD.BirA*-Flag | This study | Lentivirally transduced stable cell line |
|
| Transfected construct (H. sapiens) |
MCF10A.tGFP.P2A.PTPRK.C1089S.BirA*-Flag | This study | Lentivirally transduced stable cell line |
|
| Transfected construct (H. sapiens) |
MCF10A PTPRK KO pooled.nuclear mApple | This study | Lentivirally transduced stable cell line |
|
| Transfected construct (H. sapiens) |
MCF10A.nuclear mApple | This study | Lentivirally transduced stable cell line |
|
| Antibody | Rabbit monoclonal anti-PTPRK | This study | 2 .G6 | Western blot: 1:1000 |
| Antibody | Rabbit monoclonal anti-PTPRK | This study | 2 .H4 | Western blot: 1:1000 |
| Antibody | Rabbit monoclonal anti-PTPRK | This study | 2 .H5 | Western blot: 1:1000 |
| Antibody | Rabbit monoclonal anti-PTPRK | This study | 1 .F4 | FACS (1:200) and Immunofluorescence (IF; 1:200) |
| Antibody | Mouse anti-PTPRK | Santa Cruz Biotechnology | Cat#Sc- 374315 | Western blot: 1:1000 (note: we did not observe any specific signal for PTPRK with this antibody) |
| Antibody | Rabbit anti-PARD3 | Sigma | Cat#HPA030443 (lot: C105765) | Western blot: 1:1000 |
| Antibody | Rabbit anti-PARD3 | Merck Millipore | Cat#07–330 | Western blot: 1:1000 |
| Antibody | Mouse anti-RAPGEF6 | Santa Cruz Biotechnology |
Cat#sc-398642 (F-8) | Western blot: 1:1000 |
| Antibody | Mouse anti-Afadin | BD Transduction Labs | Cat#610732 | Western blot: 1:1000 |
| Antibody | Mouse anti-DLG5 | Santa Cruz Biotechnology |
Cat#SC374594 (A-11) | Western blot: 1:1000 |
| Antibody | Mouse anti-PTPN14 | R and D Systems | Cat#MAB4458 | Western blot: 1:1000 |
| Antibody | Mouse anti-E-Cadherin | BD Transduction Labs |
Cat#610181 | Western blot: 1:1000 IF: 1:100 |
| Antibody | Rabbit anti-b-Catenin | Cell Signaling Technology |
Cat#9562S | Western blot: 1:1000 |
| Antibody | Rabbit anti-Phospho-EGFR (Y1068) | Cell Signaling Technology |
Cat#3777S | Western blot: 1:1000 |
| Antibody | Rabbit anti-EGFR | Cell Signaling Technology |
Cat#4267S | Western blot: 1:1000 |
| Antibody | Rabbit anti-phospho-tyrosine(P-Tyr-1000) | Cell Signaling Technology |
Cat#8954 | Western blot: 1:2000 |
| Antibody | Rabbit anti-MAP4K4 | Cell Signaling Technology |
Cat#5146 | Western blot: 1:1000 |
| Antibody | Rabbit anti-NUFIP2 | Bethyl Laboratories, Inc |
Cat#A301-600A | Western blot: 1:1000 |
| Antibody | Rabbit anti-FMRP1 | ThermoFisher Scientific |
Cat#MA5-15499 | Western blot: 1:1000 |
| Antibody | Rabbit anti-MINK1/MAP4K6 | ThermoFisher Scientific |
Cat#PA5-28901 | Western blot: 1:1000 |
| Antibody | Rabbit anti-PKP4 | Bethyl Laboratories, Inc |
Cat#A304-649A | Western blot: 1:1000 |
| Antibody | Mouse anti-P120 catenin | BD Transduction Laboratories |
Cat#610133 | Western blot: 1:1000 IF: 1:100 |
| Antibody | Mouse anti-GM130 | BD Transduction Laboratories |
Cat#610822 | Western blot: 1:1000 |
| Antibody | Rabbit anti-STAT3 | Cell Signaling Technology |
Cat#4904S | Western blot: 1:1000 |
| Antibody | Rabbit anti-Paxillin | Cell Signaling Technology |
Cat#12065 (D9G12) | Western blot: 1:1000 |
| Antibody | Mouse anti-Tubulin (Alpha) | Sigma | Cat#T6199 | Western blot: 1:1000 |
| Antibody | Mouse anti-PTPRM | Santa Cruz | Cat#sc-56959 | Western blot: 1:1000 |
| Antibody | Rabbit anti-PKP3 | Abcam | Cat#AB109441 | Western blot: 1:10000 |
| Antibody | Rabbit-anti-ABLIM3 | Sigma | Cat#HPA003245 | Western blot: 1:1000 |
| Antibody | Rabbit-Anti-ZO2 | ThermoFisher Scientific |
Cat#711400 | Western blot: 1:1000 |
| Antibody | Rabbit-anti-Phospho-P120 catenin (Y904) | Cell Signaling Technology |
Cat#2910 | Western blot: 1:1000 |
| Antibody | Rabbit-anti-Phospho-P120 catenin (Y228) | Cell Signaling Technology |
Cat#2911 | Western blot: 1:1000 |
| Antibody | Rabbit polyclonal anti-Phospho-Paxillin (Y118) | Cell Signaling Technology |
Cat#2541 | Western blot: 1:1000 |
| Antibody | Rabbit-anti-b-Actin | SIGMA | Cat#A2066 | Western blot: 1:1000 |
| Antibody | Mouse-anti-DSG3 | Bio-Rad | Cat#MCA2273T | Western blot: 1:5000 |
| Antibody | HRP conjugated-Donkey anti-Rabbit IgG |
Jackson Immuno-Research |
Cat#711-035-152 | Western blot: 1:5000 |
| Antibody | HRP conjugated- Donkey anti-Mouse IgG | Jackson Immuno-Research |
Cat#711-035-152 | Western blot: 1:5000 |
| Antibody | HRP conjugated- Mouse anti-Rabbit IgG (Conformation specific) | Cell Signaling Technology |
Cat#5127S | Western blot: 1:2000 |
| Antibody | Atto-488 Goat Anti-mouse IgG | Sigma | Cat#62197 | IF: 1:400 |
| Antibody | Atto-488 Goat Anti-mouse IgG | Sigma | Cat#62197 | IF: 1:400 |
| Antibody | Alexa Fluor-647 Goat Anti Rabbit IgG | Jackson Immuno-Research |
Cat#111-605-003 | IF: 1:400 |
| Recombinant DNA reagent |
pCW57.tGFP.P2A.MCS | Addgene | Cat#71783 | |
| Recombinant DNA reagent |
pRK.HA.PTPRK.flag | Genentech | Corresponds to Uniprot identifier: Q15262-3 |
|
| Recombinant DNA reagent |
pRK.PTPRK(1-752).IgG1 | Genentech | ||
| Recombinant DNA reagent |
pET15b | J. Deane | ||
| Recombinant DNA reagent |
pSP.Cas9.(BB).eGFP | D Ron | ||
| Recombinant DNA reagent |
pMD2.G | Addgene | Cat#12259 | |
| Recombinant DNA reagent | psPAX2 | Addgene | Cat#12260 | |
| Recombinant DNA reagent |
pLenti-puro | Addgene | Cat#39481 | |
| Recombinant DNA reagent |
PTPRK-BirA-R118G-Flag | A-C Gingras | ||
| Recombinant DNA reagent |
pCW57.tGFP.P2A.PTPRK | This study | ||
| Recombinant DNA reagent |
pCW57.tGFP.P2A.PTPRK.C1089S | This study | ||
| Recombinant DNA reagent |
pCW57.tGFP.P2A.PTPRK(1-785).BirA-R118G.Flag | This study | ||
| Recombinant DNA reagent |
pCW57.tGFP.P2A.PTPRK.C1089S.BirA-R118G.Flag | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.PTPRK.ICD | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.PTPRK.ICD.D1057A | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.PTPRK.ICD.C1089S | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.PTPRK.D1 | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.PTPRK.D2 | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi. PTPRK.D2.triple |
This study | Mutations: A1346P, S1347D, L1384S, E1427Q, A1428T |
|
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.PTPRM.ICD | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.PTPRM.D1 | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi. PTPRK-D1_K-D2. | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.PTPRM-D1_M-D2 | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.PTPRK-D1_M-D2. | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.PTPRM-D1_K-D2. | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.Src.sbSH2 | This study | ||
| Recombinant DNA reagent |
pET15b.His.TEV.Avi.Grb2.sbSH2 | This study | ||
| Recombinant DNA reagent |
pSP.Cas9.PTPRK.sgRNA1 | This study | ||
| Recombinant DNA reagent |
pSP.Cas9.PTPRK.sgRNA2 | This study | ||
| Sequence-based reagent | ON-TARGETplus Human PTPRK siRNA | Dharmacon, GE Healthcare |
Cat#J-004204–06 | |
| Sequence- based reagent |
ON-TARGETplus Non-targeting pool siRNA | Dharmacon, GE Healthcare |
Cat#D-001810-10-05 | |
| Sequence- based reagent |
PTPRK CRISPR, BbsI.PTPRKgRNA1.Fwd | SIGMA | CACCGCATGGATACGACTGCGGCGG | |
| Sequence- based reagent |
PTPRK CRISPR, BbsI.PTPRKgRNA1.Rev | SIGMA | AAACCCGCCGCAGTCGTATCCATGC | |
| Sequence- based reagent |
PTPRK CRISPR, BbsI.PTPRKgRNA2.Fwd | SIGMA | CACCGATCTCGGGTGGTAGATAATG | |
| Sequence- based reagent |
PTPRK CRISPR, BbsI.PTPRKgRNA2.Rev | SIGMA | AAACCATTATCTACCACCCGAGATC | |
| Sequence- based reagent |
TaqMan probe: Hs02338565_gH (RPL19) | Thermo Fisher Scientific |
Cat#4331182 | |
| Sequence- based reagent |
TaqMan probe: Hs00267788_m1 (PTPRK) | Thermo Fisher Scientific |
Cat#4331182 | |
| Sequence- based reagent |
TaqMan probe: Hs00267809_m1 (PTPRM) | Thermo Fisher Scientific |
Cat#4331182 | |
| Sequence- based reagent |
TaqMan probe: Hs00179247_m1 (PTPRT) | Thermo Fisher Scientific |
Cat#4331182 | |
| Sequence- based reagent |
TaqMan probe: Hs00963911_m1 (PTPRU) | Thermo Fisher Scientific |
Cat#4351372 | |
| Peptide, recombinant protein |
DADE-pTyr-LIPQQG- phospho-peptide |
Cambridge Research Biochemicals |
Cat#crb1000746 | |
| Peptide, recombinant protein |
END-pTyr-INASL-phospho-peptide | Cambridge Research Biochemicals |
Cat#crb1000745 | |
| Peptide, recombinant protein |
Catalase | Sigma | Cat#C134514 | |
| Peptide, recombinant protein |
Cholera Toxin | Sigma | Cat#C-8052 | |
| Peptide, recombinant protein |
Insulin | Sigma | Cat#I-1882 | |
| Peptide, recombinant protein |
Epidermal Growth Factor | Peprotech | Cat#AF-100-15-1MG | |
| Peptide, recombinant protein |
Lysyl endopeptidase (LysC) | Wako | Cat#129–02541 | |
| Peptide, recombinant protein |
Trypsin (proteomics grade) | Thermo Fisher Scientific |
Cat#90058 | |
| Commercial assay or kit |
BIOMOL Green reagent | ENZO | Cat#BML-AK111-0250 | |
| Commercial assay or kit |
Phosphate standard | ENZO | Cat#BML-KI102-0001 | |
| Commercial assay or kit |
Q5 High-Fidelity DNA Polymerase | New England Biolabs |
Cat#M0491S | |
| Commercial assay or kit |
Phusion Hot Start II DNA polymerase | Thermo Fisher Scientific |
Cat#F549L | |
| Commercial assay or kit |
EZ-ECL substrate | Geneflow | Cat#K1-0170 | |
| Commercial assay or kit |
NuPAGE MES (2-ethanesulfonic acid) SDS running buffer |
ThermoFisher Scientific |
Cat#NP0002 | |
| Commercial assay or kit |
InstantBlue | Expedeon | Cat#ISB1L | |
| Commercial assay or kit |
Phosphatase inhibitor cocktail | Roche | Cat#04906845001 | |
| Commercial assay or kit |
TaqMan Universal Master Mix II | Applied Biosystems | Cat#4440040 | |
| Commercial assay or kit |
MycoAlertTM PLUS Mycoplasma Detection Kit | Lonza | #LT07-705 | |
| Commercial assay or kit |
MycoProbe Mycoplasma Detection Kit | R and D Systems | #CUL001B | |
| Chemical compound, drug |
Hydrogen peroxide | Thermo Fisher Scientific |
Cat#H/1750/15 | |
| Chemical compound, drug |
Sodium orthovanadate | Alfa Aesar | Cat#J60191 | |
| Chemical compound, drug |
250 kDa-FITC-dextran | Sigma | Cat#FD250S-100MG | |
| Chemical compound, drug |
Para-Nitrophenol-phosphate (pNPP) | New England Biolabs | Cat#P0757 | |
| Chemical compound, drug |
IPTG | Generon | Cat#GEN-S-02122 | |
| Chemical compound, drug |
D-biotin | Sigma | Cat#B4639 | |
| Chemical compound, drug |
L-glutamine | Sigma | Cat#G7513 | |
| Chemical compound, drug |
Hydrocortisone | Sigma | Cat#H-0888 | |
| Chemical compound, drug |
Puromycin | Thermo Fisher Scientific |
Cat#A11138-03 | |
| Chemical compound, drug |
Phosphate free H2O | Thermo Fisher Scientific |
Cat#10977–035 | |
| Chemical compound, drug |
8M Guanidine HCl | Thermo Fisher Scientific |
Cat#24115 | |
| Chemical compound, drug |
EPPS pH 8.5 | Alfa Aesar | Cat#561296 | |
| Chemical compound, drug |
Trifluoroacetic Acid (TFA) | Thermo Fisher Scientific |
Cat#28904 | |
| Chemical compound, drug |
Acetonitrile | VWR | Cat#8364.290 | |
| Chemical compound, drug |
Sodium phosphate dibasic (Na2HPO4) |
Acros Organics | Cat#343811000 | |
| Chemical compound, drug |
NH4OH | Acros Organics | Cat#460801000 | |
| Chemical compound, drug |
Methanol-free 16% (w/v) paraformaldehyde (PFA) |
Thermo Fisher Scientific |
Cat#28906 | |
| Software, algorithm | Maxquant | Computational Systems Biochemistry |
Max Planck Institute of Biochemistry |
|
| Software, algorithm | Perseus | Computational Systems Biochemistry |
Max Planck Institute of Biochemistry |
|
| Software, algorithm | FIJI/ImageJ | Laboratory for Optical and Computational Instrumentation |
University of Wisconsin-Madison |
|
| Software, algorithm | Zen Blue | Zeiss | ||
| Software, algorithm | Zen Black | Zeiss | ||
| Software, algorithm | Graphpad | Prism | ||
| Software, algorithm | Chimera | UCSF | ||
| Other | HRP-conjugated Streptavidin |
Thermo Fisher Scientific |
Cat#434323 | |
| Other | STABLE competent E. coli | NEB | Cat#C3040I | |
| Other | DH5alpha competent E. coli |
Invitrogen | Cat#18265017 | |
| Other | BL21 DE3 Rosetta E. coli | J Deane | N/A | |
| Other | DMEM | Thermo Fisher Scientific |
Cat#41965–039 | |
| Other | Ham's F-12 | Sigma | Cat#N4888 | |
| Other | Horse Serum | Thermo Fisher Scientific |
Cat#16050–122 | |
| Other | Fibroblast growth medium (FGM) |
Promocell | Cat#C-23010 | |
| Other | Fetal Bovine Serum | Sigma | Cat#F7524-500ml | |
| Other | Trypsin-EDTA solution | Sigma | Cat#T3924 | |
| Other | GeneJuice transfection reagent |
Merck Millipore | Cat#70967–3 | |
| Other | EDTA-free protease inhibitors |
Roche | Cat#11836170001 | |
| Other | Lipofectamine RNAiMax | Invitrogen | Cat#13778075 | |
| Other | OptiMEM | Thermo Fisher Scientific |
Cat#31985070 | |
| Other | Lipofectamine LTX | ThermoFisher Scientific |
Cat#15338100 | |
| Other | Protein G agarose beads | Merck Millipore | Cat#16–266 | |
| Other | Ni-NTA agarose | QIAGEN | Cat#1018244 | |
| Other | Streptavidin-coated magnetic beads |
New England Biolabs |
Cat#S1420S | |
| Other | Streptavidin agarose | ThermoFisher Scientific |
Cat#20357 | |
| Other | DMEM SILAC media | Thermo Fisher Scientific |
Cat#PI89985 | |
| Other | Ham's F-12 SILAC media | Thermo Fisher Scientific |
Cat#88424 | |
| Other | Heavy Arginine + 10 | Sigma | Cat#608033–250 mg | |
| other | Heavy Lysine + 8 | Sigma | Cat#608041–100 mg | |
| Other | Proline | Sigma | Cat#P0380 | |
| Other | Light Arginine | Sigma | Cat#A5006 | |
| Other | Light Lysine | Sigma | Cat#L5501 | |
| Other | Hoechst 33342 | Thermo Fisher Scientific |
Cat#62249 | |
| Other | BODIPY 558/568 phalloidin | Invitrogen | Cat#B3475 | IF: 1:400 |
| Other | ProLong Gold antifade | Invitrogen | Cat#P36934 | |
| Other | Normal Serum Block | BioLegend | Cat#927502 | |
| Other | Matrigel | Corning | Cat#356231 | |
| Other | 0.2 mm nitrocellulose membrane |
GE Healthcare | Cat#15289804 | |
| Other | 0.4 mm pore size Transwell filter |
Corning | Cat#353095 | |
| Other | 24-well companion plates for Transwell filters |
Corning | Cat#353504 | |
| Other | Millicell ERS-2 Volt/Ohm meter |
Merck Millipore | Cat#MERS00002 | |
| Other | Superdex 200 16/600 column |
GE Healthcare | Cat#28-9893-35 | |
| Other | Superdex 75 16/600 column |
GE Healthcare | Cat#28-9893-33 | |
| Other | Ultracel-3K regenerated cellulose centrifugal filter |
Merck Millipore | Cat#UFC900324 | |
| Other | Ultracel-10 K regenerated cellulose centrifugal filter |
Merck Millipore | Cat#UFC901024 | |
| Other | Ultracel-30 K regenerated cellulose centrifugal filter |
Merck Millipore | Cat#UFC903024 | |
| Other | NuPAGE 4–12% Bis-Tris gel | Thermo Fisher Scientific |
Cat#NP0321BOX | |
| Other | 1.5 ml low protein binding centrifuge tubes |
Eppendorf | Cat#0030 108. 116 | |
| Other | 1cc/50 mg Sep-Pak Vac tC18 cartridges |
Waters | Cat#WAT054960, | |
| Other | 1.5 ml Diagenode sonicator tubes |
Diagenode | Cat#C30010010 | |
| Other | 5 ml low protein binding centrifuge tubes |
Eppendorf | Cat#0030 108.302 | |
| Other | 2 ml low protein binding centrifuge tubes |
Thermo Fisher Scientific |
Cat#88379 | |
| Other | Graphite spin columns | Thermo Fisher Scientific |
Cat#88302 | |
| Other | Titansphere Phos-TiO Tips (200 ml/3 mg) |
GL Sciences Inc | Cat#5010–21311 | |
| Other | 18 mm x 18 mm,1.5 mm thick high- performance coverslips |
Zeiss | Cat#474030-9000-000 |