Table 4.
The primers used for PCR amplification of Y chromosome-specific probe
| Size of PCR product | Type of primer | Sequence of primer 5′ - > 3’ | |
|---|---|---|---|
| btDYZ1 | 243 bp | Forward | TGTAGATGTGTGTGCCATCC |
| Reverse | ACCGGTTCCACAGTCTCTAG |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.