Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Agarose gel electrophoresis (2%) for 100 v/mAmp for 80 min of Malassezia spp. DNA products generated through ITS 3 (GCATCGATGAAGAACGCAGC), and ITS4 (TCCTCCGCTTATTGATATGC) primers, stained with Ethidium bromide; M: Molecular marker (100bp); lanes 1H, 2H, 3H: M. furfur (509bp); lanes H4: M. globosa (430bp); lanes H5: M. pachydermatis (483bp)
