KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| anti-CDK1 | Santa Cruz Biotechnology | Cat# sc-954; RRID:AB_631207 |
| anti-CDK2 | Santa Cruz Biotechnology | Cat# sc-163; RRID:AB_631215 |
| anti-CDK4 | Cell Signaling | Cat# 12790; RRID:AB_2631166 |
| anti-CDK4 | Santa Cruz Biotechnology | Cat# sc-23896; RRID:AB_627239 |
| anti-CDK6 | Cell Signaling | Cat# 13331; RRID:AB_2721897 |
| anti-CDK6 | Santa Cruz Biotechnology | Cat# sc-7961; RRID:AB_627242 |
| anti-cyclin D1 | Cell Signaling | Cat# 2922; RRID:AB_2228523 |
| anti-cyclin D2 | Cell Signaling | Cat# 3741; RRID:AB_2070685 |
| anti-cyclin D3 | Cell Signaling | Cat# 2936; RRID:AB_2070801 |
| anti-cyclin E | Santa Cruz Biotechnology | Cat# sc-247; RRID:AB_627357 |
| anti-p21 | Cell Signaling | Cat# 2947; RRID:AB_823586 |
| anti-p27 | Cell Signaling | Cat# 2552; RRID:AB_10693314 |
| anti-pRb-Ser807/811 | Cell Signaling | Cat# 9308; RRID:AB_331472 |
| anti-pRb-thr356 | Abcam | Cat# ab4780; RRID:AB_304617 |
| anti-Rb | Cell Signaling | Cat# 9309; RRID:AB_823629 |
| anti-SMAD4 | Cell Signaling | Cat# 38454; RRID:AB_2728776 |
| anti-TGFβ | Santa Cruz Biotechnology | Cat# sc-146; RRID:AB_632486 |
| anti-TGFβ-R1 | Santa Cruz Biotechnology | Cat# sc-398; RRID:AB_632493 |
| anti-TGFβ-R2 | Santa Cruz Biotechnology | Cat# sc-400; RRID:AB_632497 |
| anti-TGFβ-R3 | Abcam | Cat# ab78421; RRID:AB_2202598 |
| anti-V5 | GenScript | Cat# A01733; RRID:AB_2622219 |
| anti-β-Actin | GenScript | Cat# A00702; RRID:AB_914102 |
| anti-mouse IgG HRP secondary | GE Healthcare | Cat# 45000679; RRID:AB_772210 |
| anti-rabbit IgG HRP secondary | GE Healthcare | Cat# 45000682; RRID:AB_2722659 |
| Biological Samples | ||
| 44 breast cancer biopsies | Dana-Farber Cancer Institute | part of voluntary research protocol 05-246 |
| Paired parotid cancer biopsies | See Infante et al., 2016 | NCT01237236 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Palbociclib | Selleckchem | Cat# S1116 |
| Palbociclib (bulk) | MedChem Express | Cat# HY-A0065 |
| Ribociclib | Selleckchem | Cat# S7440 |
| Abemaciclib | Selleckchem | Cat# S5716 |
| Puromycin Dihydrochloride | Sigma Aldrich | Cat# P8833 |
| DMEM | Thermo Fisher Scientific | Cat# 11965118 |
| RPMI 1640 | Thermo Fisher Scientific | Cat# 11875119 |
| McCoy’s 5A | Thermo Fisher Scientific | Cat# 16600082 |
| EMEM | Thermo Fisher Scientific | Catt# 11095080 |
| DMSO | Sigma Aldrich | Cat# D8418 |
| Lipofectime 3000 | Thermo Fisher Scientific | Cat# L3000008 |
| Trizol | Thermo Fisher Scientific | Cat# 15596026 |
| Galunisertib | Selleckchem | Cat# S2230 |
| Insulin | Sigma Aldrich | Cat# I9278 |
| FBS | Gemini Bio-Products | Cat# 900-108 |
| Penicillin-Streptomycin | Thermo Fisher Scientific | Cat# 15140163 |
| Ampicillin | Sigma Aldrich | Cat# A5354 |
| Kanamycin | Thermo Fisher Scientific | Cat# 15160054 |
| LB Agar | Thermo Fisher Scientific | Cat# DF040117 |
| Protease Inhibitor Cocktail Set I | Calbiochem | Cat# 539131 |
| Phosphatase Inhibitor Cocktail Set I | Calbiochem | Cat# 524624 |
| Phosphatase Inhibitor Cocktail Set II | Calbiochem | Cat# 524625 |
| RIPA Buffer | Boston BioProducts | Cat# BP-115 |
| Total Exosome Isolation Reagent | Thermo Fisher Scientific | Cat# 4478359 |
| Crystal Violet | Sigma Aldrich | Cat# C6158 |
| Sodium L-lactate | Sigma Aldrich | Cat# L7022 |
| Propidium Iodide/Rnase buffer | Thermo Fisher Scientific | Cat# BDB550825 |
| GW4869 | Sigma Aldrich | Cat# D1692 |
| Manumycin A | Santa Cruz Biotechnology | Cat# 200857 |
| Chloroform | Sigma Aldrich | Cat# 288306 |
| Critical Commercial Assays | ||
| Human Cytokine Array Kit | R&D Systems | Cat# ARY005 |
| miRNA Profiling Array (7th Gen) | Exiqon | Cat# 208500 |
| Affymetrix Human Genome U133A 2.0 array | Affymetrix | Cat# 900468 |
| SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing | CloneTech | Cat# 634888 |
| NEBNext Small RNA Library Prep Set for Illumina | New Englend BioLabs | Cat# E7330S |
| Annexin V: FITC Apoptosis Detection Kit | Thermo Fisher Scientific | Cat# BDB556547 |
| AllPrep DNA/RNA Mini Kit | QIAGEN | Cat# 80204 |
| PureLink RNA Mini Kit | Thermo Fisher Scientific | Cat# 12183025 |
| Total Exosome RNA & Protein Isolation Kit | Thermo Fisher Scientific | Cat# 4478545 |
| miRCURY LNA RT Kit | Exiqon/QIAGEN | Cat# 339340 |
| nanoString nCounter v2 Cancer CNV Assay | nanoString | Cat# XT-CSO-CAN2-12 |
| EXOCET Exosome Quantitation Kit | System Biosciences | Cat# EXOCET96A-1 |
| CellTiter-Glo | Promega | Cat# G7572 |
| ThruPLEX DNA-Seq Kit | Rubicon Genomics | Cat# R400675 |
| Library Quantification Kit | Kapa Biosystems | Cat# 07960140001 |
| Deposited Data | ||
| Gene expression array 1 | Gene Expression Omnibus | GEO: GSE117748, GSE117742 |
| Gene expression array 2 | Gene Expression Omnibus | GEO: GSE117748, GSE117743 |
| miRNA array | Gene Expression Omnibus | GEO: GSE117748, GSE117745 |
| RNaseq | Gene Expression Omnibus | GEO: GSE117748, GSE117746 |
| miRNaseq | Gene Expression Omnibus | GEO: GSE117748, GSE117747 |
| Experimental Models: Cell Lines | ||
| MCF7 | ATCC | Cat# HTB-22 |
| T47D | ATCC | Cat# HTB-133 |
| BT-20 | ATCC | Cat# HTB-19 |
| SK-BR-3 | ATCC | Cat# HTB-30 |
| ZR-75-1 | ATCC | Cat# CRL-1500 |
| 293T | ATCC | Cat# CR-3216 |
| Experimental Models: Organisms/Strains | ||
| NCr-Foxn1NU nude mice | Taconic | Cat# NCRNU-F; RRID:IMSR_TAC:ncrnu |
| Oligonucleotides | ||
| hsa-miR-432-5p miRVana miRNA mimic | Thermo Fisher Scientific | Cat# 4464066 |
| miR-432-5p LNA PCR primer set | Exiqon/QIAGEN | Cat# 204776 |
| Synthetic microRNA Inhibitor, Human hsa-miR-432-5p | Sigma Aldrich | Cat# HSTUD0572 |
| Primers for qPCR, see Table S1 | Thermo Fisher Scientific | Cat# A15612 |
| CDK6 sgRNA-7: CCGCTCCACCCGCTCATCGT | Thermo Fisher Scientific | Cat# A15612 |
| Non-Target sgRNA: CGTGATGGTCTCGATTGAGT | Thermo Fisher Scientific | Cat# A15612 |
| ON-TARGETplus CDK6 siRNA set of 4 | Dharmacon | Cat# LU-003240-00-0002 |
| ON-TARGETplus CDK4 siRNA set of 4 | Dharmacon | Cat# LU-003238-00-0002 |
| ON-TARGETplus NT siRNA | Dharmacon | Cat# D0018100105 |
| Recombinant DNA | ||
| psPAX2 | Addgene | Cat# 12260; RRID:Addgene_12260 |
| pCMV-VSV-G | Addgene | Cat# 8454; RRID:Addgene_8454 |
| lentiCRISPR v2 | Addgene (Sanjana et al., 2014) | Cat# 52961; RRID:Addgene_52961 |
| pLEX_307 | Addgene | Cat# 41392; RRID:Addgene_41392 |
| pLKO.1 | Addgene (Moffat et al., 2006) | Cat# 10878; RRID:Addgene_10878 |
| Gene art sythetic constructs - CDK6 cDNA | Thermo Fisher Scientific | NA |
| Gene art sythetic constructs - GFP cDNA | Thermo Fisher Scientific | NA |
| Gene art sythetic constructs - SMAD4 cDNA | Thermo Fisher Scientific | NA |
| shCDK1 pLKO.1 | Harvard Plasmid Core | Cat# TRCN0000000583 |
| shCDK2 pLKO.1 | Harvard Plasmid Core | Cat# TRCN0000039958 |
| shCDK4 pLKO.1 | Harvard Plasmid Core | Cat# TRCN0000010472 |
| shCDK6-1 pLKO.1 | Harvard Plasmid Core | Cat# TRCN0000039744 |
| shCDK6-2 pLKO.1 | Harvard Plasmid Core | Cat# TRCN0000039747 |
| shCCND1 pLKO.1 | Harvard Plasmid Core | Cat# TRCN0000040039 |
| shCCND3 pLKO.1 | Harvard Plasmid Core | Cat# TRCN0000003827 |
| shCCNE1 pLKO.1 | Harvard Plasmid Core | Cat# TRCN0000045302 |
| Non-Target control - shNT pLKO.1 | Dharmacon | Cat# RHS6848 |
| Software and Algorithms | ||
| GraphPad Prism 7 | GraphPad Software | https://www.graphpad.com/scientific-software/prism/ |
| Transcriptome Analysis Console (version 4.0.1.36) | Applied Biosystems | https://www.thermofisher.com/us/en/home/global/forms/life-science/download-tac-software.html |
| Combenefit (version 2.021) | Di Veroli et al., 2016 | https://sourceforge.net/projects/combenefit/ |
| STAR | Dobin et al., 2013 | https://github.com/alexdobin/STAR |
| bcl2fastq | Illumina | https://support.illumina.com/downloads/bcl2fastq-conversion-software-v2-20.html |
| Seqbuster | Pantano et al., 2010, 2011 | https://github.com/lpantano/seqbuster |
| Cufflinks | Trapnell et al., 2010 | http://cole-trapnell-lab.github.io/cufflinks/ |