Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Kdm6a | NA | MGI:1095419 | Also called Utx |
| Genetic reagent (Mus musculus) |
Ddx4-Cre | Hu et al., 2013 | B6-Ddx4tm1.1(cre/mOrange)Dcp
RRID:MGI:5554603 |
Also called Mvh-Cre |
| Genetic reagent (Mus musculus) |
Kdm6a(fl) | Welstead et al., 2012 | B6;129S4-Kdm6atm1c(EUCOMM)Jae/J RRID:IMSR_JAX:021926) |
|
| Antibody | Mouse monoclonal anti-H3K27me3 |
Abcam | ab6002 RRID:AB_305237 |
1:1000 |
| Antibody | Rabbit polyclonal anti-H3K27me3 |
Millipore Sigma | 07–449 RRID:AB_310624 |
1:1000 |
| Antibody | Rabbit polyclonal anti-H3K4me1 |
Abcam | ab8895 RRID:AB_306847 |
1:1000 |
| Antibody | Rabbit polyclonal anti-H3K27ac |
Abcam | ab4729 RRID:AB_2118291 |
1:1000 |
| Antibody | Mouse monoclonal anti-Gapdh |
Santa Cruz Biotechnology |
sc-32233 RRID:AB_627679 |
1:1000 |
| Antibody | Rat monoclonal anti-F4/80 |
Serotec | MCA497GA RRID:AB_323806 |
clone CI:A3-1; 1:5000 |
| Antibody | Rabbit monoclonal anti-VEGF-A |
Abcam | ab52917 RRID:AB_883427 |
clone EP1176Y; 1:100 |
| Antibody | Rabbit monoclonal anti-ERG |
Abcam | ab133264 RRID:AB_11156852 |
1:250 |
| Antibody | Rabbit monoclonal anti-TTF-1 |
Abcam | ab76013 RRID:AB_1310784 |
1:250 |
| Antibody | Rabbit polyclonal anti-GS | Abcam | ab73593 RRID:AB_2247588 |
1:1000 |
| Antibody | Mouse monoclonal anti-CD20 |
Dako | M0755 RRID:AB_2282030 |
clone L26; 1:500 |
| Antibody | Rabbit polyclonal anti-CD3 |
Dako | A0452 RRID:AB_2335677 |
clone F7.2.38; 1:250 |
| Sequence-based reagent |
RT-qPCR primer, Actb-F | this paper | AGAAGGACTCCTATGTGGGTGA | |
| Sequence-based reagent |
RT-qPCR primer, Actb-R | this paper | CATGATCTGGGTCATCTTTTCA | |
| Sequence-based reagent |
RT-qPCR primer, Sycp2-F | this paper | AGTCTGAGCTGATGTTATCATA | |
| Sequence-based reagent |
RT-qPCR primer, Sycp2-R | this paper | GAAGCAGAAGTAGAAGAGGC | |
| Sequence-based reagent |
RT-qPCR primer, Prm2-F | this paper | GCTGCTCTCGTAAGAGGCTACA | |
| Sequence-based reagent |
RT-qPCR primer, Prm2-R | this paper | AGTGATGGTGCCTCCTACATTT | |
| Sequence-based reagent |
RT-qPCR primer, Aqp8-F | this paper | GGATGTCTATCGGTCATTGAG | |
| Sequence-based reagent |
RT-qPCR primer, Aqp8-R | this paper | GAATTAGCAGCATGGTCTTGA | |
| Sequence-based reagent |
RT-qPCR primer, Lin28a-F | this paper | TGGTGTGTTCTGTATTGGGAGT | |
| Sequence-based reagent |
RT-qPCR primer, Lin28a-R | this paper | AGTTGTAGCACCTGTCTCCTTT | |
| Commercial assay or kit |
Zymo ChIP Clean and Concentrator kit | Zymo Research | D5201 | |
| Commercial assay or kit |
Accel-NGS 2S plus DNA library kit | Swift Biosciences | 21024 | |
| Commercial assay or kit |
DNEasy Blood andTissue kit | Qiagen | 69504 | |
| Commercial assay or kit |
Ovation RRBS Methyl-Seq System | NuGen | 0353 | |
| Commercial assay or kit |
RNEasy Plus Mini kit | Qiagen | 74134 | |
| Commercial assay or kit | TruSeq RNA library prep kit |
Illumina | RS-122–2001 | |
| Software, algorithm | R | R Core Team | RRID:SCR_001905 | https://http://www.R-project.org/ |
| Software, algorithm | Fastx toolkit v0.0.14 | http://hannonlab.cshl.edu/fastx_toolkit/commandline.html | RRID:SCR_005534 | |
| Software, algorithm | MACS v1.4 | Zhang et al., 2008 | RRID:SCR_013291 | |
| Software, algorithm | MACS v2.1 | Zhang et al., 2008 | RRID:SCR_013291 | |
| Software, algorithm | bowtie v1.2 | Langmead et al., 2009 | RRID:SCR_005476 | |
| Software, algorithm | bowtie v2.0 | Langmead and Salzberg, 2012 | RRID:SCR_016368 | |
| Software, algorithm | trim-galore v0.4.2 | https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ | RRID:SCR_011847 | |
| Software, algorithm | bismark v0.16.3 | Krueger and Andrews, 2011 | RRID:SCR_005604 | |
| Software, algorithm | phenogram | http://visualization.ritchielab.psu.edu/phenograms/document | ||
| Software, algorithm | DESeq2 (R package) | Love et al., 2014 | RRID:SCR_015687 | |
| Software, algorithm | kallisto v0.43.0 | Bray et al., 2016 | RRID:SCR_016582 | |
| Software, algorithm | AME | McLeay and Bailey, 2010 | RRID:SCR_001783 | |
| Software, algorithm | methylKit (R package) | Akalin et al., 2012 | RRID:SCR_005177 | |
| Software, algorithm | rms (R package) | https://cran.r-project.org/web/packages/rms/index.html | ||
| Software, algorithm | survival (R package) | https://CRAN.R-project.org/package=survival | ||
| Software, algorithm | FactoMineR (R package) | Le et al., 2008 | RRID:SCR_014602 |