REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal anti-NDP52	Abcam	Cat# ab68588; RRID:AB_1640255
Rabbit polyclonal anti-NDP52	Gift from John Kendrick-Jones (LMB, Cambridge)	N/A
Mouse polyclonal anti-NDP52	Abnova	Cat# H00010241-B01P; RRID:AB_1571984)
Rabbit polyclonal anti-Beta Actin	Abcam	Cat# ab8227; RRID:AB_2305186
Rabbit monoclonal anti-ATG13 (E1Y9V)	Cell Signaling Tehnology	Cat# 13468
Rabbit polyclonal anti-FIP200	ProteinTech	Cat# 10043-2-AP; RRID:AB_2253571
Mouse monoclonal anti-FLAG M2	Sigma-Aldrich	Cat# F1804; RRID:AB_262044
Goat polyclonal anti-Galectin8	R and D Systems	Cat# AF1305; RRID:AB_2137229
Rabbit polyclonal anti-ATG101	Sigma Aldrich	Cat# SAB4200175; RRID:AB_10640756)
Mouse monoclonal anti-Renilla Luciferase clone 5B11.2	Merck Millipore	Cat# MAB4400; RRID:AB_95116
Mouse monoclonal anti-ULK1	Santa Cruz	Cat# sc-390904
Rabbit polyclonal anti-GFP	Abcam	Cat# ab290;RRID:AB_303395
Mouse anti-p62/SQSTM1	BD Transduction Laboratories	Cat# 610832; RRID:AB_398151
Alexa-conjugated anti-mouse	Thermo Fisher Scientific	N/A
Alexa-conjugated anti-rabbit	Thermo Fisher Scientific	N/A
Alexa-conjugated anti-goat	Thermo Fisher Scientific	N/A
Bacterial and Virus Strains
Salmonella enterica serovar Typhimurium strain 12023	Gift from David Holden (Imperial College London)	N/A
S. Typhimurium pFPV25.1-mCherry	This study
S. Typhimurium pFPV25.1-BFP	This study
Chemicals, Peptides, and Recombinant Proteins
Lipofectamine RNAiMAX	Thermo Fisher Scientific
VECTASHIELD HardSet Antifade Mounting Medium with DAPI	Vector Laboratories	Cat# H-1500
ProLong Gold Antifade Mountant	Thermo Fisher Scientific	Cat# P36930
Polyethylenimine (PEI)	Polysciences	Cat# 23966-2
Complete Protease Inhibitor Cocktail	Roche	Cat #4693116001
Gentamicin	Thermo Fisher Scientific	Cat #15750045
Glutathione 4b Sepharose	GE Healthcare Life Sciences	Cat #17-0756-01
Anti-FLAG M2 agarose resin	Sigma Aldrich	Cat #A2220
FLAG peptide	Sigma Aldrich	Cat #F3290
Critical Commercial Assays
Renilla Luciferase Assay	Promega	Cat #E2810
RNeasy Plus Mini Kit	QIAGEN	Cat# 74134
Amersham ECL	GE Healthcare Life Sciences	Cat# RPN2106
ProQuest Two-Hybrid System		Cat# PQ10001-01
SuperScript III reverse transcriptase kit	Thermo Fisher Scientific	Cat# 18080093
Power SYBR qPCR green kit	Applied Biosystems	Cat# 4368577
Experimental Models: Cell Lines
HeLa	American Tissue Culture Collection	RRID:CVCL_0030
HEK293ET	Lab strain	RRID:CVCL_6996
Oligonucleotides
Stealth RNAi siRNA Negative Control, Med GC	Thermo Fisher Scientific	Cat# 12935300
Stealth siRNA NDP52 custom design 5′-GGGAGACAGAGCUGCUUCAACUGAA	Thermo Fisher Scientific	N/A
Stealth siRNA FIP200	Thermo Fisher Scientific	Cat# HSS190643
Stealth siRNA ATG101 custom design 5′- GACUGUGACUUCAUCGACUUCACUU	Thermo Fisher Scientific	N/A
Stealth siRNA ATG13 custom design 5′-CCAUGUGUGUGGAGAUUUCACUUAA	Thermo Fisher Scientific	N/A
Stealth siRNA Galectin-8	Thermo Fisher Scientific	Cat# HSS106038
Silencer Select Negative Control No. 1	Thermo Fisher Scientific	Cat# 4390843
Silencer Select siRNA ULK1	Thermo Fisher Scientific	Cat# s15964
Silencer Select siRNA ULK2	Thermo Fisher Scientific	Cat# s18705
siRNA OPTN custom design 5′-CCACCAGCUGAAAGAAGCCUU	Dharmacon	N/A
siRNA p62/SQSTM1	Dharmacon	Cat# D-010230-02-0005
Recombinant DNA
pETM30-FIP200 ΔN1115	This study	N/A
pETM30-FIP200 ΔN1276	This study	N/A
pETM30-FIP200 ΔN1351	This study	N/A
pETM30-FIP200 ΔN1441	This study	N/A
pETM30-FIP200 ΔN1480	This study	N/A
pETM30-NDP52	This study	N/A
pETM30-NDP52 20-127	This study	N/A
pETM30-SINTBAD 5-85	This study	N/A
pETM11-SINTBAD 5-85	This study	N/A
pETM11 NAP1 5-75	This study	N/A
M5P- FIP200 ΔN1115-Luciferase	This study	N/A
M5P-Luciferase-ATG101	This study	N/A
M5P-Luciferase-ATG13	This study	N/A
M5P-Luciferase-ULK1	This study	N/A
M5P-Luciferase-ULK2	This study	N/A
M5P-Luciferase-NDP52	This study	N/A
M5P-Luciferase-NDP52 N420	This study	N/A
M5P-Luciferase-NDP52 ΔN126	This study	N/A
M5P-Luciferase-SINTBAD ΔN5	This study	N/A
M5P-Luciferase-SINTBAD ΔN15	This study	N/A
M5P-Luciferase-SINTBAD IL11-12SS	This study	N/A
M5P-Luciferase-CALCOCO1	This study	N/A
M5P-Luciferase-TAX1BP1	This study	N/A
M5P-Luciferase-NDP52 I24N	This study	N/A
M5P-Luciferase-NDP52 Y70H	This study	N/A
M5P-Luciferase-NDP52 Y96S	This study	N/A
M5P-Luciferase-NDP52 A119Q	This study	N/A
M5P-Luciferase-NDP52 K64E	This study	N/A
M5P-Luciferase-NDP52 E68K	This study	N/A
M5P-Luciferase-NDP52 F72A	This study	N/A
M5P-Luciferase-NDP52 Y97A	This study	N/A
M5P-Luciferase-NDP52 K100E	This study	N/A
M5P-FIP200 ΔN1115 L1462A-Luciferase	This study	N/A
M5P-FIP200 ΔN1115 E1463A-Luciferase	This study	N/A
M5P-FIP200 ΔN1115 R1464A-Luciferase	This study	N/A
M5P-FIP200 ΔN1115 T1465A-Luciferase	This study	N/A
M5P-FIP200 ΔN1115 L1466A-Luciferase	This study	N/A
M5P-FIP200 ΔN1115 Q1467A-Luciferase	This study	N/A
M5P-FIP200 ΔN1115 L1468A-Luciferase	This study	N/A
M5P-FIP200 ΔN1115 A1567S-Luciferase	This study	N/A
M5P-FIP200 ΔN1115 N1572S-Luciferase	This study	N/A
M5P-FIP200 ΔN1115 F1574S-Luciferase	This study	N/A
M5P-FIP200 ΔN1115 V1576S-Luciferase	This study	N/A
M5P-FLAG-GFP	This study	N/A
M5P-FLAG-SINTBAD	This study	N/A
M5P-FLAG-SINTBAD IL11-12SS	This study	N/A
M5P-FLAG-NAP1	This study	N/A
M6P-NDP52-IRES-PAC	This study	N/A
M6P-NDP52 Y96S-IRES-PAC	This study	N/A
M6P-NDP52 A119Q-IRES-PAC	This study	N/A
M6P-GFP-FIP200 ΔN1115-IRES-Bsr (BlasticidinR)	This study	N/A
M6P-GFP-SINTBAD-IRES-Bsr	This study	N/A
M6P-GFP-WIPI1-IRES-Bsr	This study	N/A
M6P-GFP-LC3B-IRES-Bsr	This study	N/A
Software and Algorithms
GraphPad Prism	https://www.graphpad.com/scientific-software/prism/	N/A
Zeiss ZEN	https://www.zeiss.com/microscopy/int/products/microscope-software/zen-lite.html	N/A
aCOLyte3	https://www.synbiosis.com/acolyte-software/	N/A
Proteome Discoverer	https://www.thermofisher.com/order/catalog/product/OPTON-30795	N/A
HD-Examiner Software	http://massspec.com/hdexaminer/	N/A
Other
HIS-Trap chromatography cartridge	Fisher Scientific	Cat# 11773209
PD-10 desalting column	GE Lifesciences	Cat# 17-0851-01
MonoS cation exchange column	GE Lifesciences	Cat# 17518001
HiLoad 16/600 Superdex 75 column	GE Lifesciences	Cat# 28989333
Resource Q anion exchange column	GE Lifesciences	Cat# 17117701
Poroszyme Immobilized Pepsin cartridge	Applied Biosystems	Cat# 2-3131-00
Acquity 1.7 μm particle 100 mm x 1 mm C18 UPLC Column	Waters	Cat# 186002346
Vivaspin concentrators, various molecular weight cut-offs	Sartorius	N/A